Chemical ablation method for recombinant plant virus

A plant virus, chemical inactivation technology, applied in the field of chemical inactivation of recombinant plant viruses, can solve the problem of no related reports on plant virus inactivation

Inactive Publication Date: 2008-01-02
SHANGHAI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no relevant report on the use of β-propiolactone for the inactivation of plant viruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chemical ablation method for recombinant plant virus
  • Chemical ablation method for recombinant plant virus
  • Chemical ablation method for recombinant plant virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] The exogenous protein S1241 used in this example is a small peptide with a length of 12 amino acids, which is derived from a predicted possible epitope in the S protein of SARS virus, that is, 12 amino acids from positions 1241 to 1252. It is inserted between the 152nd and 153rd amino acids of TMV CP protein, and then a stop codon TAG is added to form a fusion protein with CP to form recombinant tobacco mosaic virus TMVS1241. The inserted amino acid sequence and the nucleotide sequence encoding it are as follows:

[0065] Amino acid sequence: DDSEPVLKGVKL

[0066]Nucleotide sequence: 5'-GACGACTCTGAGCCTGTTCTAAAGGGTGTTAAATTA-3'.

[0067] 1. Preparation of recombinant virus TMVS1241

[0068] 1. Construction of recombinant virus TMVS1241: constructed according to the method described by Li Qiaoli et al. (2006), Virology 348: 253-259)

[0069] 2. Extraction of recombinant virus TMVS1241 particles:

[0070] 2-4 weeks after the recombinant virus TMVS1241 infected tobacco,...

Embodiment 2

[0075] Embodiment two: Recombinant virus TMVS1241 safety detection test:

[0076] 1. Using reverse transcription PCR (RT-PCR) to detect the genome of the recombinant virus TMVS1241.

[0077] Two to three weeks after the inactivated TMVS1241 was inoculated with sensitive tobacco, total RNA was extracted from new leaves. Reverse transcription with primer Pst(-): 5'ACGTCTGCAGACTGGGCCCCTACCGGGGGTAA3'. Using the reverse transcription product as a template, primer Pst(-) and primer Acc2(+):

[0078] 5'TAGAGTAGACGACGCAACGGTGGCCATAA3' was amplified by PCR at an annealing temperature of 55°C for 25 cycles. The product should be a 517bp fragment.

[0079] The results of RT-PCR showed that the recombinant virus genome was not detected in the new leaves of sensitive tobacco inoculated with TMV-S1241 treated with β-propiolactone at concentrations of 1:1000 and 1:500. This shows that the recombinant virus has not infected tobacco and has been successfully inactivated, as shown in Figure...

Embodiment 3

[0082] Embodiment three: Recombinant virus SDS-PAGE and Western blot analysis

[0083] The SDS-PAGE results of the total protein of TMVS1241 are shown in Figure 5. After inactivation of β-propiolactone, no degradation bands appeared in the fusion CP of the recombinant virus, indicating the stability and integrity of the exogenous small peptide expressed by the recombinant TMV virus Unaffected, it is beneficial to the later utilization of exogenous polypeptides.

[0084] Using rabbit serum against exogenous small peptide S1241 as the primary antibody, and alkaline phosphatase-coupled goat anti-rabbit IgG as the secondary antibody, protein immunoblotting (Western blot) was carried out. The results are shown in Fig. 6. The antibody specific to the small peptide of S1241 had hybridization signals with the CP protein of TMVS1241 treated with various concentrations of β-propiolactone. The results of Western blot immunohybridization experiments showed that the exogenous polypeptides...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chemical inactivating method of recombinant plant virus, which adopts beta-propiolactone to do chemical inactivation for virus. The invention has advantages of simple operation, simple equipment request, express economy, good repeatability and wide scale of inactivating virus, which doesn't affect the subsequent utilization of exogenetic polypeptide of recombinant virus under the condition of high-effective inactivating the recombinant virus particle.

Description

technical field [0001] The invention relates to a chemical inactivation method for recombinant plant viruses. Background technique [0002] Most of the research on virus inactivation involves the inactivation of animal viruses. Inactivation methods mainly include chemical inactivation methods such as photochemical methods, peroxides, alcohols, phenols, and chlorine-containing disinfectants, and physical inactivation methods such as gamma rays, heating methods, and pasteurization methods. β-Propiolactone (β-Propiolactone) is a heterocyclic compound, its role is to change the nucleic acid structure by reacting with purine bases (mainly guanine) to achieve the purpose of inactivation. At the same time, it has little effect or damage on the protein. So far, there is no relevant report on the inactivation of β-propiolactone for plant viruses. Contents of the invention [0003] The object of the present invention is to provide a chemical inactivation method for recombinant pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/06C12N7/01
Inventor许政暟宋任涛李平朱广文慈云青
OwnerSHANGHAI UNIV