Method for preparing recombinant canine alpha-type interferon
A technology for interferon and recombinant protein, which is applied to the preparation method of peptide, interferon, and botanical equipment and method, etc., can solve the problems of high technical conditions of canine leukocyte interferon, difficulty in obtaining wide application and high cost. , to achieve no toxic side effects, no environmental pollution, good curative effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0032] Preparation process of recombinant canine α-type interferon:
[0033] 1. Construct the cloning vector:
[0034]犬α型IFN的目的基因为: atggccctgc cctgctcctt ctcggtggcc ctggtgctgctcagctgcca ctccctgtgc tgtctggctt gcgacctgcc cgacacccac agcctgcgca actggagggtcctgacgctc ctgggacaga tgaggagact ctccgccagc tcttgtgacc actacaccac tgactttgccttccccaagg aactgtttga tggccagcgg ctccaggagg cgcaagccct ctctgtggtc cacgtgatgacccagaaggt cttccacctc ttctgcacga acatgtcctc tgctccttgg aacatgaccc tcctgggggaattgtgctcg gggctctctg agcagctgga tgacctggat gcctgtcccc tgcaggaggc agggctggccgagacccccc tcatgcatga agactccacc ctgaggacct acttccaaag gatctccctc tacctgcaagacaggaacca cagcccgtgt gcctgggaga tggtccgagc agaaatcggg agatccttct tctccttgaccatcttgcaa gaaagagtaa ggaggaggaa atga
[0035] Specific primers: upstream: AAT TTG CCA CCT GCC CGA CA
[0036] Downstream: GAT CTT TCC TCC TCC TGA TTC TTT C
[0037] After amplifying the target gene of canine α-interferon by PCR with specific primers, clone the target g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com