Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lectin compositions and methods for modulating an immune response to an antigen

A composition and lectin technology, applied in the field of multifunctional molecules, can solve the problems of severe local inflammation in the human body, weak immune regulators, limited value, etc.

Inactive Publication Date: 2008-02-06
GENITRIX LLC
View PDF18 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, many are weaker immunomodulators, and some cause severe local inflammation that the body cannot tolerate
Purified soluble peptides such as cytokines offer some advantages over crude adjuvants, but limit their value due to their diffusion from the antigen upon administration
While certain cell surface molecules can be potential immunomodulators, such as components of cell-based vaccines, the application of which usually involves gene transfer to cells is often problematic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0600] The starting point for generating yeast expression vectors is the pUC19-GM-CSF-mammalian GPI signal sequence plasmid (pUC19-GM-CSF-GPI). This plasmid encodes a modified signal sequence of mouse GM-CSF (upstream) and human Thy-1GPI (downstream) fused in the framework. The following two oligonucleotides were purchased from Midland Certified Reagent Company (Midland, TX):

[0601] GTX-5

[0602] 5’pAATTCCGCGCCGGCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAGGGCATCA

[0603] GCCTGCTGGCTCAGAACACCTCGTGGCTGCTGCTGCTCCTGCTGTCCCTCTCCCTCCT

[0604] CCAGGCCACGGATTTCATGTCCCTGTGACTGGGTAC3’

[0605] GTX-5 contains:

[0606] a. The sequence (base 1-5) suitable for linking to the EcoRI site at the 5'end;

[0607] b. NgoM1 site (bases 9-14) used to generate in-frame chimeric coding sequences

[0608] c. The coding sequence of the GPI modified sequence in human Thy-1 (Genbank registration No. M11749) (base 15-137)

[0609] d. Stop codon (base 138-140)

[0610] e. 3'end is suitable for the sequence to be ...

Embodiment 2

[0651] Example 2. Expression in yeast of murine GM-CSF fused with Gas1 GPI modification signal sequence

[0652] 50 ml of 50 ml of culture containing PITY-GMCSF-Gas1.1 was grown in LB containing 100 μg / ml kanamycin, purified using Qiagen's MIDI-PREP kit. Lithium acetate (LIAC) scheme was used to transform Saccharomyces BJ5464 (ATCC) with PITY-GMCSF-Gas1.1. 10 ml of BJ5464 in a 100 mL BJ5464 in 10 ml BJ5464 in a 10 ml BJ5464 per liter of 20 g of parent extract, 20 g of glucose, 20 g of glucose. The yeast was given at 30 ° C for 3 hours and then centrifuged at 12,000 × g for 2 minutes at room temperature for 2 minutes. Cells were washed with sterile water and centrifuged again. The cells were resuspended in 1.0 mL of 100 mM LIA, transferred to a 1.5 ml centrifuge tube, centrifuged in the Eppendorf centrifuge for 15 seconds. The cells were then resuspended in a 100 mm LIAC in 0.5 ml, and 50 μl of samples were subjected to 50 μl of samples into each tube. Cell precipitation. Then 2...

Embodiment 3

[0658] Example 3. Binding of mouse GM-CSF fused with Gas1 GPI modified signal sequence to cells

[0659] The wild-type CMS-5 murine fibrosarcoma cells grown in DMEM, 10% FBS, and Pen-Strep were harvested, washed twice with RPMI 1640 (Life Technologies), and measured at 5×10 5 The concentration of cells / ml was resuspended in RPMI1640. Dispense 0.9 ml aliquots of the cell suspension into Eppendorf siliconized centrifuge tubes. Each received 1μg purified GPI-GM-CSF prepared in Example 2, 1μg soluble recombinant mouse GM-CSF (Intergen, supplied as a lyophilized powder, reconstituted at 40μg / ml in the same buffer of GPI-GM-CSF ), or just accept medium. The cells were then shake cultured at 37°C for 3 hours, and then washed 3 times with PBS containing 2% FBS.

[0660] In order to detect GPI-GM-CSF by flow cytometry, the cells and rat anti-mouse GM-CSF monoclonal antibody (Endogen) were incubated at 4°C for 1 hour. Then the cells were washed 3 times with PBS containing 2% FBS, incubated...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a fusion polypeptide comprising at least about 10 contiguous amino acid residues of an influenza virus hemagglutinin and at least about 5 contiguous amino acids of a naturally occurring GM-CSF molecule.

Description

Background of the invention [0001] Generally, the specific regulation of the immune response to the antigen in the patient requires the mixed administration of another substance, such as an adjuvant and the antigen, to initiate and / or direct the regulation. However, traditional adjuvants have many disadvantages. For example, many are crude heterologous preparations. In addition, many are weaker immunomodulators, and some also cause severe local inflammation that the human body cannot tolerate. Purified soluble polypeptides such as cytokines have some advantages over crude adjuvants, but because they diffuse from the antigen during administration, their value is limited. However, certain cell surface molecules can be potential immunomodulators, such as cell-based vaccine components, and their applications usually involve gene transfer to cells, which is often problematic. [0002] Therefore, the present invention fills the hitherto unresolved need by providing molecules that can bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/12C12Q1/68A61K39/145C12P21/06C07K1/00A61K39/00A61K38/00C07K14/11C07K14/535
CPCC07K2319/02A61K2039/55522C07K14/535C07K2319/42C07K2319/00C12N2760/16122C12N2760/16134A61K39/145A61K38/00A61K39/00A61K2039/5152C07K14/005A61K39/12A61K2039/6031
Inventor 安德鲁·H·塞加尔埃尔胡·扬
Owner GENITRIX LLC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com