Lectin compositions and methods for modulating an immune response to an antigen
A composition and lectin technology, applied in the field of multifunctional molecules, can solve the problems of severe local inflammation in the human body, weak immune regulators, limited value, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0600] The starting point for generating yeast expression vectors is the pUC19-GM-CSF-mammalian GPI signal sequence plasmid (pUC19-GM-CSF-GPI). This plasmid encodes a modified signal sequence of mouse GM-CSF (upstream) and human Thy-1GPI (downstream) fused in the framework. The following two oligonucleotides were purchased from Midland Certified Reagent Company (Midland, TX):
[0601] GTX-5
[0602] 5’pAATTCCGCGCCGGCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAGGGCATCA
[0603] GCCTGCTGGCTCAGAACACCTCGTGGCTGCTGCTGCTCCTGCTGTCCCTCTCCCTCCT
[0604] CCAGGCCACGGATTTCATGTCCCTGTGACTGGGTAC3’
[0605] GTX-5 contains:
[0606] a. The sequence (base 1-5) suitable for linking to the EcoRI site at the 5'end;
[0607] b. NgoM1 site (bases 9-14) used to generate in-frame chimeric coding sequences
[0608] c. The coding sequence of the GPI modified sequence in human Thy-1 (Genbank registration No. M11749) (base 15-137)
[0609] d. Stop codon (base 138-140)
[0610] e. 3'end is suitable for the sequence to be ...
Embodiment 2
[0651] Example 2. Expression in yeast of murine GM-CSF fused with Gas1 GPI modification signal sequence
[0652] 50 ml of 50 ml of culture containing PITY-GMCSF-Gas1.1 was grown in LB containing 100 μg / ml kanamycin, purified using Qiagen's MIDI-PREP kit. Lithium acetate (LIAC) scheme was used to transform Saccharomyces BJ5464 (ATCC) with PITY-GMCSF-Gas1.1. 10 ml of BJ5464 in a 100 mL BJ5464 in 10 ml BJ5464 in a 10 ml BJ5464 per liter of 20 g of parent extract, 20 g of glucose, 20 g of glucose. The yeast was given at 30 ° C for 3 hours and then centrifuged at 12,000 × g for 2 minutes at room temperature for 2 minutes. Cells were washed with sterile water and centrifuged again. The cells were resuspended in 1.0 mL of 100 mM LIA, transferred to a 1.5 ml centrifuge tube, centrifuged in the Eppendorf centrifuge for 15 seconds. The cells were then resuspended in a 100 mm LIAC in 0.5 ml, and 50 μl of samples were subjected to 50 μl of samples into each tube. Cell precipitation. Then 2...
Embodiment 3
[0658] Example 3. Binding of mouse GM-CSF fused with Gas1 GPI modified signal sequence to cells
[0659] The wild-type CMS-5 murine fibrosarcoma cells grown in DMEM, 10% FBS, and Pen-Strep were harvested, washed twice with RPMI 1640 (Life Technologies), and measured at 5×10 5 The concentration of cells / ml was resuspended in RPMI1640. Dispense 0.9 ml aliquots of the cell suspension into Eppendorf siliconized centrifuge tubes. Each received 1μg purified GPI-GM-CSF prepared in Example 2, 1μg soluble recombinant mouse GM-CSF (Intergen, supplied as a lyophilized powder, reconstituted at 40μg / ml in the same buffer of GPI-GM-CSF ), or just accept medium. The cells were then shake cultured at 37°C for 3 hours, and then washed 3 times with PBS containing 2% FBS.
[0660] In order to detect GPI-GM-CSF by flow cytometry, the cells and rat anti-mouse GM-CSF monoclonal antibody (Endogen) were incubated at 4°C for 1 hour. Then the cells were washed 3 times with PBS containing 2% FBS, incubated...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com