RBP4 antibody and its preparation method and use

A polyclonal antibody and monoclonal antibody technology, applied in the field of retinol-binding protein, can solve the problems of inability to meet the sensitivity requirements, difficult for antibodies to detect natural proteins, and unsatisfactory detection effect.

Inactive Publication Date: 2008-04-23
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the current prior art, recombinant proteins prepared based on natural proteins and using prokaryotic expression systems often have some characteristics different from natural proteins, making it difficult to detect natural proteins with antibodies prepared by using them, or the detection effect is not ideal, and cannot reach clinical sensitivity requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RBP4 antibody and its preparation method and use
  • RBP4 antibody and its preparation method and use
  • RBP4 antibody and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Prokaryotic protein expression

[0061] The present inventors extracted mRNA from human liver tissue, used GGCGGATTCCTGGGCAAGAT (SEQ ID NO: 1) as a forward primer, and GATGGGGAGAGAAGGGCAAA (SEQ ID NO: 2) as a reverse primer, and obtained the RBP4 gene by RT-PCR. The cloned gene was verified by sequencing to contain no meaningful mutations. By adding primers with BamH I and Xho I restriction sites at both ends (with CGCGGATCCATGAAGTGGGTGTGGGCGCTCTT (SEQ ID NO: 3) as the forward primer and CCGCTCGAGGCTACAAAAGGTTTCTTTCTGATC (SEQ ID NO: 4) as the reverse primer), the inventors will clone the The gene was connected to the BamH I and Xho I sites of the pET28a vector to obtain the pET28a-RBP4 recombinant plasmid.

[0062] Afterwards, the recombinant plasmid was transformed into BL21 expressing Escherichia coli, induced under the condition of 0.5mM IPTG, and the expressed protein mainly existed in the inclusion body. The RBP4 protein expressed in the inclusion body...

Embodiment 2

[0064] Example 2: Animal immunization

[0065] Mice were immunized with RBP4 purified in Example 1. Balb / c mouse immunization dose: 0.1 mg each time. Multiple intramuscular injections. Immunization program: 0, 3, 6 three times immunization. Three days before the fusion, 0.1 mg protein was injected intraperitoneally for memory stimulation.

[0066] Rabbits were immunized with RBP4 purified in Example 1. Immune dose of big-eared rabbits: 0.5mg each time. Multiple intramuscular injections. Immunization program: 0, 3, 6 three times immunization. Blood was collected after titer assessment.

Embodiment 3

[0067] Example 3: Construction of hybridoma cell lines and preparation of monoclonal antibodies

[0068] Fusion was done three days after recall stimulation. The spleen cells of the immunized mice were fused with the mouse myeloma cell SP2 / 0 by conventional fusion method of polyethylene glycol (PEG).

[0069] After fusion, HAT selective medium was added, and ELISA was used for screening, and the antigen used for screening was the purified RBP4 protein in Example 1.

[0070] A monoclonal antibody was obtained after cloning and screening by limiting dilution three times, named S-18-16.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of retinol conjugated protein and its preparation process and specific antibody. The present invention expresses retinol conjugated protein effectively for the first time, and the expressed retinol conjugated protein has property near to that of natural retinol conjugated protein (RBP4). Immunizing animal with the expressed retinol conjugated protein can obtain antibody capable of recognizing natural retinol conjugated protein in human body sensitively. The present invention fills in a gap in RBP4 antiserum.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a retinol-binding protein prepared by using a prokaryotic protein expression system, an antibody thereof and the application of the antibody. Background technique [0002] Retinol Binding Proteins (RBPs) are a class of carrier proteins responsible for transporting retinol from the liver to various target cells in the human body, and play an important role in the physiological functions of retinol. Seven different RBP subtypes have been found, mainly distributed in the blood circulatory system (RBP4, referred to as RBP), cells (RBP1, RBP2, RBP5, RBP6, RBP7, referred to as CRBPs) and between retinal photoreceptors (RBP3, referred to as IRBP) . In 1968, Kanai et al first isolated and discovered RBP from human body, and then found homologous protein of human RBP in mice, rats, pigs and other animals. So far, the protein sequence, protein crystal structure and physiological function of RB...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/12C07K14/435C12N1/21C07K16/18G01N33/53
Inventor孙兵罗敏唐琳娜蔡兴锋
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI