Construction method for broad spectrum bacterium host green fluorescence protein expression carrier
A technology of green fluorescent protein and expression vector, applied in the field of microbiology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] 1. Amplification of Amp promoter
[0027] Primers were designed according to the Amp promoter sequence, and Pvu II and BamH I restriction sites were introduced into the upstream and downstream primers respectively. The sequences of the upstream and downstream primers are:
[0028] CGCAGCTGGACGTCAGGTGGCACTTT, CGGGATCCACTC
[0029] TTCCTTTTCAATATTAT.
[0030] A small amount of plasmid pcDNA3 was extracted as a template to amplify the Amp promoter, and the 50μl PCR amplification system included 5μl 10× buffer, 2mmol / L Mg 2+ , 200μmol / L dNTPs, 200nmol / L forward and reverse primers, 1ng pcDNA3, 2.5U LA Tag DNA polymerase. The PCR program for 30 cycles is 94°C / 30s (the first cycle is 5min), 55°C / 30s, 72°C / 20s (the last cycle is 5min). The amplified products were analyzed by electrophoresis on 1% agarose gel and recovered and purified.
[0031] According to the instructions of the DNA Ligation Kit from TaKaRa Company, the amplified Amp promoter was T-cloned, that is, conne...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com