Applications of corn cytochrome P450 gene

A cytochrome and gene technology, applied in the field of genetic engineering, can solve the problem of less genetic engineering, and achieve the effect of high safety and enhanced resistance

Inactive Publication Date: 2008-05-21
ZHEJIANG UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is a lot of research on glyphosate resistance in corn, but relatively little genetic engineering of resistance to other herbicides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of corn cytochrome P450 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the cloning of relevant maize cytochrome P450 gene:

[0027] According to the sequence of the maize genome database, a DNA fragment containing a complete cytochrome P450 gene was designed by PCR amplification of the genome DNA. The cytochrome P450 gene is ZM-450A. Its cDNA sequence is SEQ ID NO: 1, and the amino acid sequence of the encoded protein is SEQ ID NO: 2. The primers for PCR amplifying ZM-450A were zm450aF: GGATCCACCATGGATAAGGCCTACGTGGCCGTG (SEQ ID NO: 3) and zm450aR: CAGTATACAGGACAACCTGCAGAAGACCACAATTT (SEQ ID NO: 4). The conditions for PCR amplification were: 95°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes, and 30 cycles were performed. These cytochrome P450 genome PCR products were cloned into a T vector (Shanghai Sangong) to obtain the pT-zm450A plasmid. Sequencing showed that the cloned gene was identical to the sequence of the database.

Embodiment 2

[0028] Embodiment 2, the construction of the T-DNA carrier of Agrobacterium transformation ZM-450A gene:

[0029] Agrobacterium-transformed T-DNA vector pCAMB1300Rice-GlyR-450i was used to construct a T-DNA vector for expressing maize cytochrome P450 gene ZM-450A in rice (Application No. 200610155661.7 "Method for Selectively Eliminating Transgenic Gramineae Plants") . The T-DNA in pCAMB1300Rice-GlyR-450i contains an RNAi fragment that inhibits the expression of the gene P450 that degrades bendazone and sulfonylurea herbicides in rice and a gene that is resistant to glyphosate herbicides. Therefore, pCAMB1300Rice-GlyR-450i will cause the sensitivity of transgenic rice to bendazone and sulfonylurea herbicides. However, if the exogenous genes that can improve the resistance to bentazone and sulfonylurea herbicides are introduced into pCAMB1300Rice-GlyR-450i at the same time, the obtained transgenic rice can still show resistance to bentazone and sulfonylurea herbicides. high r...

Embodiment 3

[0031] Embodiment 3, the acquisition of transgenic rice:

[0032] The two transformation vectors pCAMB1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i were respectively introduced into Agrobacterium LBA4404 by electric shock method. The method for obtaining transgenic rice plants is to use the existing technology (Lu Xiongbin, Gong Zuxun 1998 Life Science 10: 125-131; Liu Fan et al., 2003 Molecular Plant Breeding 1: 108-115). The mature and plump seeds of Xiushui 110 were dehulled, and callus was induced as transformation materials. Take the Agrobacterium plate containing pCAMB1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i, and pick a single colony to inoculate the Agrobacterium for transformation. Put the callus to be transformed into the appropriate concentration of Agrobacterium solution (containing acetosyringone), let the Agrobacterium bind to the surface of the callus, and then transfer the callus to the co-culture medium, and co-culture for 2 to 3 days. sk...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a maize cytochrome P450 gene, which has the nucleic acid sequence showed by SEQ ID NO: 1. The transgenic crop obtained by the gene has the capability of increasing the high resistance for bentazon or sulfonylurea herbicides. The invention also discloses a DNA plasmid, which contains an inhibiting expression frame of antisense RNA or RNAi constructed by the cytochrome P450 gene or the gene fragment of the cytochrome P450 gene. The invention also discloses a transgenic maize cell and a preparation method of transgenic maize by using the cell. The transgenic crop obtained by the DNA plasmid of the invention can decrease the resistance ability for bentazon or sulfonylurea herbicides, so that the bentazon or sulfonylurea herbicides can be applied to control the transgenic crop selectively.

Description

technical field [0001] The invention belongs to the field of genetic engineering. Specifically, the present invention relates to the use of maize cytochrome P450 gene to produce herbicide-resistant crops; and the method of using antisense RNA or RNAi constructed by the gene to obtain transgenic crops that can be selectively killed by herbicides. Background technique [0002] Genetically modified crops have been extensively planted in many countries around the world. For example, genetically modified insect-resistant and herbicide-resistant corn has been widely promoted in North America, and genetically modified cotton has also been widely planted in China. Improving the herbicide resistance of crops is an important aspect of crop improvement. Therefore, the discovery and utilization of herbicide resistance genes has important application value. There is a lot of research on maize resistance to glyphosate, but there is relatively little genetic engineering of resistance to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82
Inventor 沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap