Applications of corn cytochrome P450 gene
A cytochrome and gene technology, applied in the field of genetic engineering, can solve the problem of less genetic engineering, and achieve the effect of high safety and enhanced resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the cloning of relevant maize cytochrome P450 gene:
[0027] According to the sequence of the maize genome database, a DNA fragment containing a complete cytochrome P450 gene was designed by PCR amplification of the genome DNA. The cytochrome P450 gene is ZM-450A. Its cDNA sequence is SEQ ID NO: 1, and the amino acid sequence of the encoded protein is SEQ ID NO: 2. The primers for PCR amplifying ZM-450A were zm450aF: GGATCCACCATGGATAAGGCCTACGTGGCCGTG (SEQ ID NO: 3) and zm450aR: CAGTATACAGGACAACCTGCAGAAGACCACAATTT (SEQ ID NO: 4). The conditions for PCR amplification were: 95°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes, and 30 cycles were performed. These cytochrome P450 genome PCR products were cloned into a T vector (Shanghai Sangong) to obtain the pT-zm450A plasmid. Sequencing showed that the cloned gene was identical to the sequence of the database.
Embodiment 2
[0028] Embodiment 2, the construction of the T-DNA carrier of Agrobacterium transformation ZM-450A gene:
[0029] Agrobacterium-transformed T-DNA vector pCAMB1300Rice-GlyR-450i was used to construct a T-DNA vector for expressing maize cytochrome P450 gene ZM-450A in rice (Application No. 200610155661.7 "Method for Selectively Eliminating Transgenic Gramineae Plants") . The T-DNA in pCAMB1300Rice-GlyR-450i contains an RNAi fragment that inhibits the expression of the gene P450 that degrades bendazone and sulfonylurea herbicides in rice and a gene that is resistant to glyphosate herbicides. Therefore, pCAMB1300Rice-GlyR-450i will cause the sensitivity of transgenic rice to bendazone and sulfonylurea herbicides. However, if the exogenous genes that can improve the resistance to bentazone and sulfonylurea herbicides are introduced into pCAMB1300Rice-GlyR-450i at the same time, the obtained transgenic rice can still show resistance to bentazone and sulfonylurea herbicides. high r...
Embodiment 3
[0031] Embodiment 3, the acquisition of transgenic rice:
[0032] The two transformation vectors pCAMB1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i were respectively introduced into Agrobacterium LBA4404 by electric shock method. The method for obtaining transgenic rice plants is to use the existing technology (Lu Xiongbin, Gong Zuxun 1998 Life Science 10: 125-131; Liu Fan et al., 2003 Molecular Plant Breeding 1: 108-115). The mature and plump seeds of Xiushui 110 were dehulled, and callus was induced as transformation materials. Take the Agrobacterium plate containing pCAMB1300Rice-GlyR-450i-ZM450A and pCAMB1300Rice-GlyR-450i, and pick a single colony to inoculate the Agrobacterium for transformation. Put the callus to be transformed into the appropriate concentration of Agrobacterium solution (containing acetosyringone), let the Agrobacterium bind to the surface of the callus, and then transfer the callus to the co-culture medium, and co-culture for 2 to 3 days. sk...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com