Method for identifying HBV gene mutation type, special chip and reagent kit
A gene chip and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, etc., can solve problems such as difficult to accurately distinguish, difficult to interpret results, difficult to distinguish mutant/wild type coexisting individuals, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Embodiment 1, detect the cloning plasmid sample of known HBV mutation with gene chip of the present invention and method
[0087] 1. Mutant Cloning Plasmid Preparation
[0088] 1) Preparation of wild type plasmid pGEM-T-HBVPWT of HBV P gene
[0089] Using HBV genomic DNA as a template, use the upstream primer (sequence: CAAGGTATGTTGCCCGTTTG) and downstream primer (sequence: GGAGTTCCGCAGTATGGATCGG) to PCR amplify the nucleotide sequence from the 1448th to the 2191st deoxyribonucleotide of GenbankAccession Number AB205123 at the 5' end , the PCR product was connected to the pGEM-T Easy vector to obtain a fragment containing the HBV P coding gene from the 1448th to the 2191st deoxyribonucleotide at the 5' end of Genbank AccessionNumber AB205123 containing the nucleotide sequence The recombinant plasmid pGEM-T-HBVPWT is a wild-type plasmid including HBV P gene.
[0090] 2) HBV P gene mutant plasmids pGEM-T-HBVPMU180M, pGEM-T-HBVPMU181T, pGEM-T-HBVPMU181V, pGEM-T-HBVPMU204...
Embodiment 2
[0167] Embodiment 2, use gene chip of the present invention and method to detect the clinical sample of known HBV mutation
[0168] 1. Nucleic acid preparation of clinical samples
[0169] The isolated case samples (HBV-positive serum) with known HBV gene mutations were provided by the Institute of Liver Diseases, People's Hospital. Sample 1# is the mixed type of wild type (WT) of HBV P gene, mutant type 180M of HBV P gene and mutant type 204I of HBV P gene; sample 2# is wild type (WT) of HBV P gene, HBV P gene The mixed type of the mutant 180M of the HBV P gene and the mutant 204S of the HBV P gene; the sample 3# is the mixed type of the wild type (WT) of the HBV P gene, the mutant 181V of the HBV P gene and the mutant 236T of the HBV P gene.
[0170] Use QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) was used to extract genomic DNA from HBV positive sera.
[0171] 2. Preparation of multiplex PCR primers and probes for gene chips
[0172] (1) Primer
[0173] The ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap