Method for identifying HBV gene mutation type, special chip and reagent kit
A gene chip and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, etc., can solve problems such as difficult to accurately distinguish, difficult to interpret results, difficult to distinguish mutant/wild type coexisting individuals, etc.
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2008-05-21
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
technical field
[0001] The invention relates to a method for identifying HBV gene mutation types in the field of gene analysis, as well as a dedicated chip and a kit. Background technique
[0002] Chronic hepatitis B is one of the most serious health problems at present. About 2 billion people in the world have been infected with hepatitis B virus (HBV), of which 350 million people are chronic HBV infected people, and about 1 million people die every year. Liver failure, liver cirrhosis and primary hepatocellular carcinoma (HCC) caused by HBV infection. my country is a high prevalence area of HBV infection. There are 130 million hepatitis B virus carriers and more than 30 million hepatitis B patients in China. The positive rate of HBsAg in the general population was 9.09%. HBV is a highly mutated virus. During its reverse transcription and replication process, due to the lack of correction function of RNA polymerase and reverse transcriptase, the virus can undergo one or...
Examples
Embodiment 1
[0086] Embodiment 1, detect the cloning plasmid sample of known HBV mutation with gene chip of the present invention and method
[0087] 1. Mutant Cloning Plasmid Preparation
[0088] 1) Preparation of wild type plasmid pGEM-T-HBVPWT of HBV P gene
[0089] Using HBV genomic DNA as a template, use the upstream primer (sequence: CAAGGTATGTTGCCCGTTTG) and downstream primer (sequence: GGAGTTCCGCAGTATGGATCGG) to PCR amplify the nucleotide sequence from the 1448th to the 2191st deoxyribonucleotide of GenbankAccession Number AB205123 at the 5' end , the PCR product was connected to the pGEM-T Easy vector to obtain a fragment containing the HBV P coding gene from the 1448th to the 2191st deoxyribonucleotide at the 5' end of Genbank AccessionNumber AB205123 containing the nucleotide sequence The recombinant plasmid pGEM-T-HBVPWT is a wild-type plasmid including HBV P gene.
[0090] 2) HBV P gene mutant plasmids pGEM-T-HBVPMU180M, pGEM-T-HBVPMU181T, pGEM-T-HBVPMU181V, pGEM-T-HBVPMU204...
Embodiment 2
[0167] Embodiment 2, use gene chip of the present invention and method to detect the clinical sample of known HBV mutation
[0168] 1. Nucleic acid preparation of clinical samples
[0169] The isolated case samples (HBV-positive serum) with known HBV gene mutations were provided by the Institute of Liver Diseases, People's Hospital. Sample 1# is the mixed type of wild type (WT) of HBV P gene, mutant type 180M of HBV P gene and mutant type 204I of HBV P gene; sample 2# is wild type (WT) of HBV P gene, HBV P gene The mixed type of the mutant 180M of the HBV P gene and the mutant 204S of the HBV P gene; the sample 3# is the mixed type of the wild type (WT) of the HBV P gene, the mutant 181V of the HBV P gene and the mutant 236T of the HBV P gene.
[0170] Use QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) was used to extract genomic DNA from HBV positive sera.
[0171] 2. Preparation of multiplex PCR primers and probes for gene chips
[0172] (1) Primer
[0173] The ...