Unlock instant, AI-driven research and patent intelligence for your innovation.

Test paper for rapidly detecting hog cholera antibody and method for making same

A swine fever antibody and test strip technology, applied in the field of animal disease inspection and quarantine, can solve the problems of long detection time, high detection cost, and complicated operation process, and achieve low production costs, stable and uniform antigenic components, good repeatability

Inactive Publication Date: 2008-07-09
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the antigen preparation process of this method must go through cumbersome modes such as virus cell culture and virus purification. The specificity is not high, the stability is poor, and the cost is high; the detection requires special equipment such as a microplate reader. Personnel need to undergo professional training; the operation process is relatively complicated; the time required for detection is relatively long; the cost of detection is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper for rapidly detecting hog cholera antibody and method for making same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 The present invention detects the preparation of swine fever antibody test strip

[0031] 1 Preparation of classical swine fever E2 protein

[0032] ①Material source

[0033] (1) The source of the virus. Attenuated classical swine fever (prepared by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences).

[0034] (2) Sources of carriers, recipient bacteria and reagents. Recipient strain BL21: Diagnosis and Epidemiology Center, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences; PET-30a, restriction endonucleases and various modified enzymes were purchased from Dalian Bao Biological Company; IPTG, kanamycin: Shanghai Sangong .

[0035] (3) Primer synthesis. Primers used to amplify the gene fragment encoding the B / C antigen region: upstream of P: (5'tcgaattcatgcgtctagcctgca 3'); downstream of P: (5'tggtgagtgagtaaagcccccttat 3'), the upstream and downstream primers contain enzymes designed as EcoRI and Pst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a test paper for rapidly detecting swine fever antibody and a preparation method thereof. The inventive test paper consists of a sample pad (4), a glass fiber member (3), a cellulose nitrate membrane (2), a water absorbent pad (1) and a support (5); wherein the cellulose nitrate membrane contains a detection line (6) coated by swine fever virus E2 protein and a reference line (7) coated with rabbit anti swine fever antibody; and the glass fiber member is combined with swine fever virus E2 protein marked by colloidal gold. The test paper can rapidly detect possibly present swine fever antibody in a sample to achieve rapid detection and timely epidemic control, thus creating favorable conditions for further separation and identification. The test paper has the advantages of convenient, rapid and easy usage, clear result, easy generalization, and no need for special instrument and equipment as well as professionals, and is suitable for large-batch onsite detection for base layer and for sudden events. The test paper is suitable for epidemic inquisition and performs assistant effect on swine fever virus infection diagnosis.

Description

technical field [0001] The invention relates to a test strip for detecting animal diseases, in particular to a test strip for rapidly detecting swine fever antibodies. The invention also relates to a preparation method and an application method of the test strip, belonging to the field of animal disease inspection and quarantine. Background technique [0002] Swine fever is an acute, heat, contact, and severe infectious disease caused by swine fever virus. It can occur in pigs of any breed and age, and there is no seasonality; once the disease occurs, the fatality rate is high and the loss Huge, the World Organization for Animal Health (OIE) lists it as a class A infectious disease, and my country classifies it as a class I animal infectious disease for management, and attaches great importance to the prevention and control of the disease. [0003] At present, known swine fever antibody rapid detection kit (ELISA method), is the method that adopts enzyme-linked immunosorbent ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/558G01N33/52G01N33/531
Inventor 崔尚金
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI