Novel anti-plasmodium falciparum epitope and vaccine containing the same

A technology of Plasmodium falciparum and vaccine, applied in the field of gene development and application, can solve problems such as antigenic variation, and achieve the effect of high growth in vitro and high immunogenicity

Inactive Publication Date: 2008-11-05
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies on the screened Plasmodium antigenic proteins have confirmed that their antigenicity will continue to mutate und...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel anti-plasmodium falciparum epitope and vaccine containing the same
  • Novel anti-plasmodium falciparum epitope and vaccine containing the same
  • Novel anti-plasmodium falciparum epitope and vaccine containing the same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0029] 1. Preparation of Polyclonal Antibody

[0030] (1) Antigen

[0031] The currently known apolipoproteins can sensitize lymphocytes and form specific binding complexes with antibodies after entering a foreign body, that is, they have antigenicity. Antigenicity includes both immunogenicity and antigenic specificity. Because apolipoprotein has antigen specificity and immunogenicity, it can be called a complete antigen. The immune system of most animals is very sensitive, and only a very small amount of antigen is needed for immunization. The antigen should be a purified product. After 12.5% ​​PAG electrophoresis, only one band appears in the pure product, which means that the pure product can be used for immunization.

[0032] (2) immunity

[0033] Selection of animals: usually choose mature, mature and robust guinea pigs, chickens, rabbits, goats, sheep, horses and other animals, preferably white rabbits. For mass production, goats or sheep can be used. If there is mor...

Embodiment 1

[0044] Example 1: Gene synthesis and sequence analysis of anti-Plasmodium falciparum multi-epitope artificial antigen protein ES312

[0045] 1. Synthesis of multi-epitope artificial antigen gene ES312 and construction of engineering bacteria for eukaryotic expression. Antigens CPE, MSA-2, RESA, EBA-175, LSA-1, CST3 / CSP, MSP of different life stages of Plasmodium falciparum were selected -1, 14 epitopes of AMA-1 and MAg-1, the gene sequence ES312 corresponding to the epitope is designed according to the preference of human codons, and the sequence map of the designed gene is sent to the biological company (Shanghai Sangong) for synthesis (such as figure 1 shown in SEQ ID NO: 1), after double digestion with Bcl I and BamHI restriction endonucleases, after ligation with the eukaryotic expression vector plasmid VR1012 (VR1012 is a eukaryotic expression vector from Vical Company), competently transform Escherichia coli The SKS383 strain was screened in a culture medium with a fina...

Embodiment 2

[0048] Example 2: Recognition experiment between multi-epitope artificial antigen ES312 protein and patient serum 1. Construction of ES312-DS / BL21 genetically engineered bacteria and expression and purification of its encoded protein

[0049] The ES312 gene fragment of the recombinant plasmid VR1012-ES312 was digested with NcoI and BglII, and then connected to the Escherichia coli expression vector pDS-ex (that is, obtained by transforming the pET-30a vector with the following primers, and the N-terminus was fused with the sequence containing the His site :p30aF1:5'-CGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGA-3',p30aR1:3'TCGGGTCTGGACATGCTGCTGCTGCTGTTCCGGTACCG5',p30aF2:5'CAAGGCCATGGCGGTACCCGGATCCGAATTCGAGCTC3',p30aR2:3'CTTAAGCTCGAGTGATCAGCTGTTCGAACTCTAGAGTGAGCTCGTGGT5'),感受态转化大肠杆菌BL21株,在终浓度为25μg / ml卡那 After selection of the mycin-resistant medium, the prokaryotic expression engineered strain ES312-DS / BL21 containing the recombinant plasmid ES312-DS was obtained. The recombinan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Relative molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to the gene exploitation and application field of the biomedicine high-tech, in particular to an artificial antigen amino acid sequence which is provided with a plurality of epipositions and can be identified by blood serum of falciparum malaria sufferers and a polynucleotide sequence coded with the amino acid sequence. The invention also relates to a vaccine containing the amino acid sequence or the polynucleotide sequence. The invention further also relates to the application of the artificial antigen used for preparing the immunity preparation against the falciparum malaria parasite.

Description

technical field [0001] The invention relates to the field of development and application of genes in biomedical high technology. Specifically, the present invention relates to an amino acid sequence of an artificial antigen with multiple epitopes that can be recognized by the serum of patients with falciparum malaria and a polynucleotide sequence encoding the amino acid sequence. The present invention also relates to a vaccine containing said amino acid sequence or said polynucleotide sequence. The present invention further relates to the application of the artificial antigen in the preparation of immunosuppressants against Plasmodium falciparum infection. Background technique [0002] Malaria is one of the deadliest epidemics in the world today. There are nearly 4 billion people living in malaria endemic areas all over the world, about 300-500 million new infections appear every year, and about 2-4 million people die every year. Among the four species of Plasmodium that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/13C07K16/20C12N15/63C12N15/70C12N1/21A61K39/015A61P33/06
CPCY02A50/30
Inventor 王恒蔡启良
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap