Novel anti-plasmodium falciparum epitope and vaccine containing the same
A technology of Plasmodium falciparum and vaccine, applied in the field of gene development and application, can solve problems such as antigenic variation, and achieve the effect of high growth in vitro and high immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0029] 1. Preparation of Polyclonal Antibody
[0030] (1) Antigen
[0031] The currently known apolipoproteins can sensitize lymphocytes and form specific binding complexes with antibodies after entering a foreign body, that is, they have antigenicity. Antigenicity includes both immunogenicity and antigenic specificity. Because apolipoprotein has antigen specificity and immunogenicity, it can be called a complete antigen. The immune system of most animals is very sensitive, and only a very small amount of antigen is needed for immunization. The antigen should be a purified product. After 12.5% PAG electrophoresis, only one band appears in the pure product, which means that the pure product can be used for immunization.
[0032] (2) immunity
[0033] Selection of animals: usually choose mature, mature and robust guinea pigs, chickens, rabbits, goats, sheep, horses and other animals, preferably white rabbits. For mass production, goats or sheep can be used. If there is mor...
Embodiment 1
[0044] Example 1: Gene synthesis and sequence analysis of anti-Plasmodium falciparum multi-epitope artificial antigen protein ES312
[0045] 1. Synthesis of multi-epitope artificial antigen gene ES312 and construction of engineering bacteria for eukaryotic expression. Antigens CPE, MSA-2, RESA, EBA-175, LSA-1, CST3 / CSP, MSP of different life stages of Plasmodium falciparum were selected -1, 14 epitopes of AMA-1 and MAg-1, the gene sequence ES312 corresponding to the epitope is designed according to the preference of human codons, and the sequence map of the designed gene is sent to the biological company (Shanghai Sangong) for synthesis (such as figure 1 shown in SEQ ID NO: 1), after double digestion with Bcl I and BamHI restriction endonucleases, after ligation with the eukaryotic expression vector plasmid VR1012 (VR1012 is a eukaryotic expression vector from Vical Company), competently transform Escherichia coli The SKS383 strain was screened in a culture medium with a fina...
Embodiment 2
[0048] Example 2: Recognition experiment between multi-epitope artificial antigen ES312 protein and patient serum 1. Construction of ES312-DS / BL21 genetically engineered bacteria and expression and purification of its encoded protein
[0049] The ES312 gene fragment of the recombinant plasmid VR1012-ES312 was digested with NcoI and BglII, and then connected to the Escherichia coli expression vector pDS-ex (that is, obtained by transforming the pET-30a vector with the following primers, and the N-terminus was fused with the sequence containing the His site :p30aF1:5'-CGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGA-3',p30aR1:3'TCGGGTCTGGACATGCTGCTGCTGCTGTTCCGGTACCG5',p30aF2:5'CAAGGCCATGGCGGTACCCGGATCCGAATTCGAGCTC3',p30aR2:3'CTTAAGCTCGAGTGATCAGCTGTTCGAACTCTAGAGTGAGCTCGTGGT5'),感受态转化大肠杆菌BL21株,在终浓度为25μg / ml卡那 After selection of the mycin-resistant medium, the prokaryotic expression engineered strain ES312-DS / BL21 containing the recombinant plasmid ES312-DS was obtained. The recombinan...
PUM
Property | Measurement | Unit |
---|---|---|
Relative molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap