Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Use of human-source adiponcetin globular segment for medicine for treating diabetes and ischemic heart disease

A technology of ischemic heart disease and adiponectin, applied in the field of cytokine therapy for cardiovascular disease, to reduce infarct size, reduce myocardial cell apoptosis, and improve cardiac function

Inactive Publication Date: 2008-12-31
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although it is currently clinically possible to restore the blood supply of ischemic myocardium in patients with diabetic myocardial infarction through thrombolysis or interventional methods, there is no drug for reducing ischemia / reperfusion injury in clinical practice, which makes diabetic patients suffer from myocardial infarction. Even if the blood vessels are opened later, the prognosis is significantly worse than that of ordinary myocardial infarction patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of human-source adiponcetin globular segment for medicine for treating diabetes and ischemic heart disease
  • Use of human-source adiponcetin globular segment for medicine for treating diabetes and ischemic heart disease
  • Use of human-source adiponcetin globular segment for medicine for treating diabetes and ischemic heart disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] 1. Preparation of adiponectin globular fragment (gAd):

[0021] Total RNA was extracted from human adipose tissue with Trizol (product of Invitrogen), and reverse-transcribed into the first strand of cDNA (#18080-51) using the Invitrigen Superscript III kit. Using the reverse-transcribed cDNA as a template, adiponectin was used to The globular region-specific primer PCR obtained adiponectin globular region DNA fragment (gAdi KpnIF: 5'CCTGGAGAAGGTACCTATGTA 3'; gAdiXhoI R 5'GAGTTAGTGGCTCGAGGTTGGTGTCATG 3'). The resulting DNA fragment was digested with KpnI and XhoI and joined into the pET45b fragment obtained by the same double digestion with KpnI and XhoI. The ligated product was transferred into XL10-GOLD competent cells by heat shock method, and the obtained expression vector was sequenced. After verification, it was transformed into BL21(DE3) prokaryotic expression vector by heat shock method.

[0022] The host bacteria containing the pET45b-gAdi vector were cultured...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a medicine of anthropogenic adiponectin spherical fragment in curing diabetic-anemic cardiopathy. A gene sequence of the anthropogenic adiponectin spherical fragment obtained by the invention absolutely accords with a known gene sequence, and compared with the full-length adiponectin, the hydrolyzed anthropogenic adiponectin spherical fragment has stronger biological activity, fast reaction after dosage, good bioavailability and better clinic application prospect, especially when the diabetes patient receives a recanalization treatment after a myocardial infarction, the anemically myocardial damage of the diabetes patients can be eased by the exogenetic dosage.

Description

technical field [0001] The present invention relates to the field of application of cytokines in the treatment of cardiovascular diseases, more specifically, the application of human-derived adiponectin globular fragments (globular domain of adiponectin, gAd) in the treatment of diabetic ischemic heart disease. Background technique [0002] Cardiovascular disease, especially ischemic heart disease, is the leading cause of death in diabetic patients. The high sugar and high fat state in the blood of diabetic patients can cause vascular damage and induce the occurrence of ischemic heart disease. In addition, recent studies have shown that it can also directly damage cardiomyocytes. Therefore, diabetic patients not only have a higher incidence of ischemic heart disease than ordinary patients, but also have significantly increased myocardial vulnerability. After myocardial infarction, in the process of opening blood vessels through thrombolysis or interventional surgery, the ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/19A61K9/08A61P3/10A61P9/10
Inventor 陶凌马新亮尹涛王海昌
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products