Use of human-source adiponcetin globular segment for medicine for treating diabetes and ischemic heart disease
A technology of ischemic heart disease and adiponectin, applied in the field of cytokine therapy for cardiovascular disease, to reduce infarct size, reduce myocardial cell apoptosis, and improve cardiac function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] 1. Preparation of adiponectin globular fragment (gAd):
[0021] Total RNA was extracted from human adipose tissue with Trizol (product of Invitrogen), and reverse-transcribed into the first strand of cDNA (#18080-51) using the Invitrigen Superscript III kit. Using the reverse-transcribed cDNA as a template, adiponectin was used to The globular region-specific primer PCR obtained adiponectin globular region DNA fragment (gAdi KpnIF: 5'CCTGGAGAAGGTACCTATGTA 3'; gAdiXhoI R 5'GAGTTAGTGGCTCGAGGTTGGTGTCATG 3'). The resulting DNA fragment was digested with KpnI and XhoI and joined into the pET45b fragment obtained by the same double digestion with KpnI and XhoI. The ligated product was transferred into XL10-GOLD competent cells by heat shock method, and the obtained expression vector was sequenced. After verification, it was transformed into BL21(DE3) prokaryotic expression vector by heat shock method.
[0022] The host bacteria containing the pET45b-gAdi vector were cultured...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap