Use of CR-1 siRNA in treating myocardial hypertrophy induced by AngII

A technology of cardiac hypertrophy and cr-1siRNA, which can be used in gene therapy, cardiovascular system diseases, genetic material components, etc., and can solve the problems that have not been seen before.

Inactive Publication Date: 2009-03-11
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] The application of human cell production regulator-short interfering ribonucleic acid CR-1siRNA in the treatment of cardiac hypertrophy in the present invention, so far, there has not been any relevant reports at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of CR-1 siRNA in treating myocardial hypertrophy induced by AngII
  • Use of CR-1 siRNA in treating myocardial hypertrophy induced by AngII
  • Use of CR-1 siRNA in treating myocardial hypertrophy induced by AngII

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Construction of CR-1siRNA adenovirus recombinant vector

[0036] This experiment uses the vector pSilencer3.0-H1 (Ambion Company) which has H1 promoter and can express shRNA efficiently in mammalian cells. According to the cDNA sequence of CR-1 (AF417001), design and synthesize the positive and negative double-stranded DNA oligonucleotide fragments targeting the target sequence AACAAGGCTTCTCATAACAGG,

[0037] 5′-GATCCCGCAAGGCTTCTCATAACAGGTTCAAGAGACCTGTTATGAGAAGCCTTG

[0038] TTTTTTGGAAA-3′

[0039] 5′-AGCTTTTCCAAAAAACAAGGCTTCTCATAACAGGTCTCTTGAACCTGTTATGAG

[0040] AAGCCTTGCGG-3′

[0041] After the two DNA fragments were annealed, they were ligated into the pSilencer3.0-H1 vector through the BamHI and HindIII sites to construct the pSilencer3.0-H1-CR-1siRNA recombinant vector; the H1-CR-1siRNA obtained by digestion with EcoRI / HindIII The (0.16kb) fragment is connected with the pShuttle-Basic shuttle vector (Northsay Genetics Co., Ltd.) to obtain the pShuttle-Basic-H...

Embodiment 2

[0042] Replication of mouse AngII induced cardiac hypertrophy model

[0043] Eighteen clean-grade 8-week-old C57BL / 6 mice (purchased from the Institute of Experimental Animals, Chinese Academy of Medical Sciences) were randomly divided into three groups A, B, and C on the third day after entering the laboratory, with 6 mice in each group. Group A was then randomly selected for surgery. After the mice were anesthetized with 2.5% tribromoethanol (14uL / g), a micropump (Alzet Company Model 2002) prepacked with AngII (2.5mg / (kg. The micropump treatment with prepacked solvent medium (PBS) was used as the control, and group C was set as the non-pump control group. Ultrasound (Aloka ultrasonic instrument SSD-5500, 7.5MHz probe) was used to detect the morphological changes of the mouse myocardium, and reverse transcription polymer chain reaction (RT-PCR) and Western blot were used to detect the expression of CR-1 gene (Table 1 ), ( figure 2 , 3). The results showed that the myoca...

Embodiment 3

[0048] CR-1siRNA adenovirus recombinant vector is introduced into mouse AngII-induced myocardial hypertrophy model

[0049] Take 36 clean-grade 8-week-old C57BL / 6 mice (purchased from the Institute of Experimental Animals, Chinese Academy of Medical Sciences), and on the third day after entering the laboratory, they were randomly divided into three series A, B and C. There are three experimental groups with 6 mice in each group. See Table 2 for series and experimental groupings.

[0050] Table 2 CR-1siRNA adenovirus recombinant vector introduced into AngII to treat the experimental grouping of mice

[0051]

[0052] The mice in groups 3, 6, and 9 were injected with siRNA-CR1 (2 X 10 9 pfu / μl, 200μl / d), groups 2, 5, and 8 were injected with adenovirus vector control (2 X 10 9 pfu / μl, 200μl / d), for a total of 13 days.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the application of CP-1 siRNA in treating AngII induced cardiac hypertrophy. Experimental study proves that the CP-1 siRNA can inhibit cardiac hypertrophy in mice induced by AngII, weakens the degree of ventricular dilatation and the thickness of a ventricular wall, inhibits the expression of marker protein ANF, beta-MHC of the cardiac hypertrophy, inhibits cardiac fibrosis, and is an effective novel cardiac hypertrophy treatment drug.

Description

Technical field: [0001] The present invention relates to the application of disease-related factor-short interfering ribonucleic acid in gene therapy, in particular, the application of human cell production regulator-short interfering ribonucleic acid CR-1 siRNA in the treatment of cardiac hypertrophy. Background technique: [0002] Cardiac hypertrophy is the increase in the size and weight of cardiomyocytes produced by the heart in response to various stimuli. Its pathological changes include cardiomyocyte hypertrophy, myocardial mesenchymal cell proliferation, and cardiac extracellular matrix remodeling, that is, myocardial remodeling. In cardiac hypertrophy, the protein synthesis, volume, diameter or length of cardiomyocytes increase, and the number of sarcomeres increases accompanied by fibrous tissue hyperplasia. The traditional view is that mature cardiomyocytes terminate differentiation, lose mitotic ability, and cannot enter the cell cycle. However, current evidenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61P9/00
Inventor王以光戴文建赫卫清孔维佳
OwnerMEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI