Unlock instant, AI-driven research and patent intelligence for your innovation.

Influenza antibodies, compositions, and related methods

A composition and antibody technology, applied in chemical instruments and methods, antibodies, drug combinations, etc., can solve the problems of attenuated virus and combination time-consuming and expensive

Inactive Publication Date: 2009-03-25
FRAUNHOFER USA
View PDF51 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the generation of attenuated viruses of various subtypes and combinations is time consuming and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Influenza antibodies, compositions, and related methods
  • Influenza antibodies, compositions, and related methods
  • Influenza antibodies, compositions, and related methods

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0214] The production of bispecific antibodies is generally well known in the art. One method involves the isolation and preparation of antibodies specific for an aminophospholipid or anionic phospholipid on the one hand and a therapeutic agent on the other. Preparation of pepsin F (ab') from two selected antibodies 2 fragments, followed by reduction of each antibody to provide individual Fab' sH fragment. The SH group on one of the two partners to be coupled is then alkylated with a cross-linking reagent such as O-phenylene bismaleimide to provide free maleimide on one partner base. This partner can then be joined to another using thioether linkages to generate the desired F(ab') 2 Heteroconjugates. Other techniques are known in which cross-linking with SPDP or Protein A is performed or trispecific constructs are prepared.

[0215] One method of producing bispecific antibodies is by fusing two hybridomas to form a quadroma. As used herein, the term "quadroma" is used t...

example 1

[0282] Example 1: Generation of Antigen Constructs

[0283] Antigenic sequence generated by influenza virus neuraminidase

[0284] Nucleotide sequences encoding the neuraminidases of each influenza virus type Vietnam H5N1 (NAV) and Wyoming H3N2 (NAW) were synthesized and confirmed to be appropriate. The resulting nucleic acid is digested with the restriction endonuclease SalI whose sites have been engineered to either end of the coding domain of the sequence. The resulting DNA fragment was fused in frame to the C-terminus of the sequence encoding the engineered thermostable carrier molecule.

[0285] NAV(N1) (SEQ ID NO.: 27):

[0286] GGATCCTTAATTAAAATGGGATTCGTGCTTTTCCTCAGCTTCCTTCTTTCCTT

[0287] CTTGTGTCTACTCTTCTTTCTTTTCCTTGTGATTTCTCACTCTTGCCGTGCTCAAA

[0288] ATGTCGACCTTATGCTTCAGATTGGAAACATGATTTCTATTTGGGTGTCACAC

[0289] TCTATTCACACTGGAAACCAGCATCAGTCTGAGCCAATTTCTAACACTAACCT

[0290] TTTGACTGAGAAGGCTGTGGCTTCTGTTAAGTTGGCTGGAAACTTCTTCTCTTT

[0291] GCCCTATTAACGGATGGGCT...

example 2

[0363] Example 2: Generation of Antigen Vectors

[0364]The target antigen construct LicKM-NA was subcloned into the selected viral vector (pBI-D4). pBI-D4 is a binary vector obtained from pBI121, in which the reporter gene encoding Escherichia coli (Escherichia coli) β-D-glucuronidase (beta-D-glucuronidase, GUS) has been inserted between the XbaI and SacI sites Cloning of the "poly-linker" replacement of the vector obtained from TMV (Figure 3). pBI-D4 is a TMV-based construct in which the foreign gene to be expressed (e.g., target antigen (e.g., LicKM-HA, LicKM-NA) replaces the coat protein (CP) gene of TMV. The virus retains the TMV 126 / 183 kDa gene , the motor protein (MP) gene, and the CP subgenomic mRNA promoter (sgp) extending into the CP open reading frame (open reading frame, ORF). The start codon of CP has been mutated. The virus lacks CP and is therefore in Movement through the phloem is not possible throughout the host plant. However, cell-cell movement of virus i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the intersection of the fields of immunology and protein engineering, and particularly to antigens and vaccines useful in prevention of infection by influenza virus. Provided are recombinant protein antigens, compositions, and methods for the production and use of such antigens and vaccine compositions.

Description

[0001] Related applications [0002] This application relates to and claims priority under 35 USC 119(e) to U.S.S.N. 60 / 844,770 filed September 15, 2006 (the '770 application); the entire contents of the '770 application are incorporated herein by reference middle. technical field [0003] none Background technique [0004] Influenza has a long history characterized by widespread infectivity, epidemics, recurrent and explosive upsurges. Influenza is a highly contagious disease that can be equally devastating in developing countries as it is in developed countries. Influenza viruses are one of the major threats to human populations. Despite annual vaccination efforts, influenza infection produces substantial morbidity and mortality. Although influenza epidemics occur almost every year, fortunately, widespread transmission does not occur frequently. However, recent strains of influenza have emerged, making us once again confronted with the possibility of widespread influ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/00A61P31/16
CPCC07K16/1018A61K2039/505C07K2316/96C07K2317/76A61P31/16A61P43/00C07K16/40C07K16/42A61K39/145
Inventor 维达季·尤西波夫吉恩·帕尔默瓦季姆·梅特
Owner FRAUNHOFER USA