Molecular marking method of corn hybrid incompatibly gene

A molecular marker and labeling technology, which is applied in the fields of biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effect of accelerating the process of variety selection and breeding.

A molecular marker and labeling technology, which is applied in the fields of biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effect of accelerating the process of variety selection and breeding.

CN101423871AInactive Publication Date: 2009-05-06BOHAI UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marking method of corn hybrid incompatibly gene
  • Molecular marking method of corn hybrid incompatibly gene
  • Molecular marking method of corn hybrid incompatibly gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] 1. Construction of Ga gene segregation population

[0042] Taking the Ga inbred line as the parent, crossing with the sweet corn inbred line or the waxy corn inbred line, and constructing Ga gene segregation population F through selfing and backcrossing 2 Generations and BC 1 generation.

[0043] 2. Genomic DNA extraction

[0044] Take 3-4g of young corn leaves and add liquid nitrogen to grind them into powder, put them into a 10mL centrifuge tube, add 5mL of 2×CTAB solution preheated at 65°C, bathe in 65°C for 60min; centrifuge at 5000rpm for 10min, transfer the supernatant to another centrifuge tube; add an equal volume of chloroform / isoamyl alcohol (24:1) and mix lightly; centrifuge at 5000rpm for 10min, transfer the supernatant to another centrifuge tube; add 1 / 100 volume of RNase A solution, and incubate at 37°C for 25min; 0.8 times the volume of isopropanol to precipitate DNA; 2mL (76% ethanol + 0.2mol / L NaAc) to wash the precipitate twice, dry it and dissolve ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for molecularly marking maize cross incompatibility genes, and the molecular marker in the method has the following specific nucleic acid base sequence: (1) SCAR / S2055 / 854 marked positive direction: 5' CAGGTTCCATTGGAACCCTA 3'; and reverse direction: 5' TCAGACCAATACTCCGGTC 3'; and (2) SCAR / M16P22 / 303 marked positive direction: 5' GAGTAACACTCAGAATAAGC 3'; and reverse direction: 5' CATGCAGATTGGCTGCTGCTG 3'. The method for molecularly marking the maize cross incompatibility genes comprises the following steps: carrying out extraction of maize genetic group DNA, mark analysis of RAPD or AFLP polymorphism, PCR amplification, purification, clone and order checking, wherein a RAPD marker is converted into an SCAR marker; the nucleic acid base sequence marked by SCAR / S2055 / 854 is used as a primer to carry out PCR reaction; an individual containing Ga gene has a characteristic strip of 854bp through electrophoretic test; or an AFLP marker is converted into the SCAR marker; the nucleic acid base sequence marked by SCAR / M16P22 / 303 is used as a primer to carry out PCR reaction; and an individual containing Ga gene has a characteristic strip of 303bp through electrophoretic test. The method has the advantages that the method can be used for maize variety breeding, can protect the maize variety from intermixing of other maize pollen by the cross incompatibility of the maize, thereby improving the purity and quality of the variety.

Description

technical field [0001] The invention provides a molecular marker method for maize hybrid incompatibility genes, belongs to the field of molecular breeding, and is used for utilization of maize germplasm resources and selection of hybrid varieties. Background technique [0002] Corn is an important food crop in my country, with a sown area of ​​24 million hectares. Due to the pollution of exogenous corn pollen in corn production, the purity of corn hybrids or corn varieties is reduced, and the appearance quality and physical and chemical properties of commercial corn are also reduced, which affects the production of special corn, corn fine processing and industrialization. [0003] In order to improve the purity and quality of corn hybrids, genetic improvement of corn is needed. Maize hybrid incompatibility is controlled by gametophyte gene (Ga). The pollen of the corn carrying the Ga gene can fertilize other corns, but the pollen of other corns cannot make it fertilize and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
06 May 2009
Publication
CN101423871A
IPC
C12Q1/68
Inventors
何余堂