Expression vector for fusion expression of green fluorescent protein, construction method and use thereof

A carrier and the technology in the sequence list, which are applied in the expression vector for fusion expression of green fluorescent protein and its construction and application fields, can solve the problems of high cost, low connection efficiency, cumbersome steps, etc., and achieve high level, simple process and ideal efficiency Effect

Inactive Publication Date: 2011-07-20
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional enzymatic digestion ligation method has problems such as cumbersome steps, high cost (need to purchase endonuclease and ligase), and low ligation efficiency. Electrophoresis, recovery and other steps before further connection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector for fusion expression of green fluorescent protein, construction method and use thereof
  • Expression vector for fusion expression of green fluorescent protein, construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, construction of pGBD-EGFP-Vector

[0031] 1) Construction of pGBD

[0032] Design primers pGBD Vector1 upstream and pGBD Vector1 downstream, pGBD Vector2 upstream and pGBDVector2 downstream, the nucleotide sequences of primers pGBD Vector1 upstream and pGBD Vector1 downstream, pGBD Vector2 upstream and pGBD Vector2 downstream are as follows:

[0033] Upstream of pGBD Vector1: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG 3';

[0034] Downstream of pGBD Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.

[0035]Upstream of pGBD Vector2: 5'CTCGAGGATATCTGCA GATATC CAGCACAC 3' (the underlined part is the EcoR V enzyme recognition site);

[0036] Downstream of pGBD Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.

[0037] Using the pEGFP-N1 (Invitrogen) plasmid as a template, fragment A was PCR amplified with primers pGBD Vector1 upstream and pGBDVector1 downstream, and pCDNA3.0 plasmid was used as a template, and fragment B was PCR amplified with primers pGBD Vector2 upstream ...

Embodiment 2

[0076] Example 2, the ability of pGBD-EGFP-Vector to express protein

[0077] 1) Construction of pGBD-M-EGFP-Vector expressing H5N1 M protein and green fluorescent protein

[0078] Design primers M upstream and M downstream, the primer sequences are as follows:

[0079] M upstream: 5' GGAATTCTGCAGATCGCCACCATGAGTCTTCTAACCG 3';

[0080] Downstream of M: 5' GCCCTTGCTCACGATCTTGAATCGTTGCATCTG 3'.

[0081] The GGAATTCTGCAGAT and GCCCTTGCTCACGA sequences in the primers are sequences capable of homologous recombination with the nucleotide sequence at positions 700-715 from the 5' end of sequence 1 and the nucleotide sequence at positions 716-730 from the 5' end of sequence 1 .

[0082] With the cDNA of H3 subtype influenza virus (Genetic analysis of H3 subtype influenza virus isolated from domestic ducks in northern China during 2004-2005, VirusGenes, I10.1007 / s 11262-008-0300-7) (China Agricultural University) as template, The M gene fragment was PCR amplified with primers M upstre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector expressing green fluorescent protein by fusion and a construction method and application thereof. The vector is in ring shape , comprising a procaryon replication origin, two eucaryon replication origins and selective marker genes, and two green fluorescent protein gene expression cassettes; the green fluorescent protein gene expression cassettes, fromupstream to downstream, consist of two promoters with the same transcription direction, junction fragments, green fluorescent protein encoding genes and polyadenylic acid AATAAA; the green fluorescent protein encoding gene lacks an initiation codon. The junction fragment comprises an EcoRV recognition sequence; the first place and the second place of the green fluorescent protein encoding gene from the end of 5' overlaps the last two places from the end of 5' of the EcoRV recognition sequence; the junction fragment comprises or does not comprise the initiation codon; when the junction fragment comprises the initiation codon, the initiation codon has a space of 2+3n or 1+3n from the first place from the end of 5' of the EcoRV recognition sequence, wherein, n is a positive integer. The vector comprises a green fluorescent protein gene, and can only express the green fluorescent protein on the condition that the gene is correctly expressed, therefore, the interference due to the expression of fluorescence by an initial vector can be effectively excluded.

Description

technical field [0001] The invention relates to an expression vector for fusion expression of green fluorescent protein and its construction method and application. Background technique [0002] Mammalian cell eukaryotic expression vector is one of the most common expression vectors and is widely used in scientific research, production and other fields. Green fluorescent protein (EGFP) is also increasingly used as a marker of gene expression in various fields of scientific research. Its product EGFP is non-toxic to cells, and its detection is simple. It can be used in fluorescence without any substrate or other auxiliary substances. Fluorescence can be directly observed under a microscope, which greatly facilitates the detection and positioning of gene expression levels. At present, eukaryotic protein green fluorescent protein co-expression plasmids are widely used in scientific research, such as studying protein expression level, localization of eukaryotic protein in mamma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/66C12P21/00
Inventor刘金华刘芹防马婧姣蒲娟
OwnerCHINA AGRI UNIV