Strongylus duodenalis anticoagulant peptide, as well as preparation and use thereof
A technology of duodenum and anticoagulant peptides, which is applied in the fields of medicine and biology, and can solve problems such as prolonged prothrombin time and weak prothrombin time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Isolation and Analysis of Coding Sequence of Anticoagulant Peptide AdAP1 from Ancylostoma duodenale
[0058] 1. Construction and sequencing screening of simple cDNA library of Ancylostoma duodenale
[0059] Fifteen adult worms of Ancylostoma duodenale obtained from humans were obtained, and total RNA was extracted with TRIzol Reagent (Invitrogen) according to the operating instructions. According to the operating instructions, 3'-Full RACE Core Set (Dalian Takara) was used to reverse transcribe the extracted total RNA of Ancylostoma duodenale to obtain the first-strand cDNA. Design the upstream primer NSL: GGTTTAATTACCCAAGTTTGAG according to the nematode spliced leader sequence (spliced leader) SL1, and use the anchor primer (SAP: CTGATCTAGAGGTACCGGATCC) sequence provided by the 3'-Full RACE Core Set kit as the downstream primer to amplify the first-strand cDNA; The amplified product was ligated into pUCm-T Vector, transformed into E.coli DH5α competent cells, and ...
Embodiment 2
[0064] Amplification of Anticoagulant Peptide AdAP1 from Ancylostoma duodenale by RT-PCR
[0065] Fifteen adult worms of Ancylostoma duodenale obtained from humans were obtained, and total RNA was extracted with TRIzol Reagent (Invitrogen) according to the operating instructions. The first-strand cDNA was obtained by reverse-transcribing the total RNA extracted from the adult worms of Ancylostoma duodenale using 3'-Full RACE Core Set (product of Takara, Dalian) according to the operating instructions. According to the amino acid sequence of the complete coding frame of AdAP1, that is, AdAP1f (SEQ ID NO.1), the predicted mature peptide sequence, that is, AdAP1m (SEQ ID NO.2), and the amino-terminal and carboxy-terminal of the predicted mature peptide are respectively missing 3 amino acids The sequence of AdAP1d (SEQ ID NO.3) is the nucleotide sequence shown in the design of primers, using Ancylostoma duodenale cDNA as a template for amplification.
[0066] The primers for ampl...
Embodiment 3
[0077] Recombinant Expression, Isolation and Purification of Anticoagulant Peptide AdAP1 from Ancylostoma duodenale
[0078] According to the coding sequence shown in sequence SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, i.e. SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, design and synthesize paired primers respectively, amplify Addition is the target fragment for further connection with the expression vector. Introduce the Kpn I enzyme cleavage site (GGTACC, see single-line underline) in the upstream primer, and a polynucleotide encoding the enterokinase cleavage site (see double-line underline. Enterokinase cleavage site amino acid sequence: DDDDK), downstream primers include Contains stop codon TGA and Xho I digestion (CTCGAG, see wavy underline).
[0079] (a) The sequences of primers dP2-1e and dP2-2e for amplifying the coding sequence of SEQ ID NO.1 (ie, SEQ ID NO.5) are as follows:
[0080] dP1-1e:
[0081] 5'-CA GGTACC ATGAAATTAATTTGTACCCAGGT-3' (containing Kpn I endonuclease...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More