Method for producing induced multipotential stem cell
A technology of pluripotent stem cells and cells, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as low efficiency, affecting application and promotion, and achieve high efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Preparation of Example 1 Class Embryonic Stem Cells
[0057] Coding regions of specific genes (Oct4, Nanog, Sox2, Lin28, c-myc, and Klf4) were amplified by polymerase chain reaction (PCR) from total human cDNA, and ligated into lentiviral vectors (construct like Figure 7 Shown, Invitrogen Company), so that it can be brought into cells by the produced lentivirus for expression. Oct-4 (also known as Oct-3, Pou5F1), GenBank accession number is NM_002701; Nanog, GenBank accession number is NP_079141; Sox2, GenBank accession number is NP_003097; Lin28, GenBank accession number is NP_078950; is NP_002458; Klf4, GenBank accession number is NP_004226. Amplification primers are listed in Table 1:
[0058] Table 1
[0059] Primer name
Primer sequence
lin28 5' primer SEQ ID NO: 1
atgggctccgtgtccaaccag
lin28 3' primer SEQ ID NO: 2
tcaattctgtgcctccggggag
C-myc 5' primer SEQ ID NO: 3
atgcccctcaacgttagcttca
C-myc 3' primer SEQ ...
Embodiment 2
[0073] The mensuration of embodiment 2 alkaline phosphatase
[0074] 1. Purpose: To identify whether the formed clone has the characteristics of embryonic stem cells by detecting the activity of alkaline phosphatase, and compare the results of the two experimental groups
[0075] 2. Method
[0076] For the experimental group transferred with 4 factors in Example 1, clones were picked on the 26th day; while for the experimental group transferred with 6 factors, clones were picked on the 17th day, which is called iPS-S. The selected clones were cultured on mouse embryonic fibroblast trophoblasts using standard human embryonic stem cell culture media and methods (Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts.Science.Nov 61998; 282(5391):1145-1147) In order to quantify the efficiency of reprogramming, we selected a flask of cells in each experiment and fixed them on day 17, and detected their alkaline phosphate Enzyme ...
Embodiment 3
[0081] The determination of embodiment 3 specific surface antigen
[0082] 1. Purpose: To further identify whether the obtained clone has the characteristics of embryonic stem cells by detecting whether it has the specific surface antigen of embryonic stem cells.
[0083] 2. Method
[0084] Using literature (Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts. Science. Nov 6 1998; 282(5391): 1145-1147 and Xiao L, YuanX, Sharkis SJ. Activin A Maintains self-renewal and regulates fibroblast growth factor, Wnt, andbone morphogenic protein pathways in human embryonic stem cells.Stem Cells.Jun2006; 24 (6): 1476-1486), respectively detect the embodiment by immunofluorescence 1 The expression of SSEA-3, SSEA-4, Tra-1-60, and Tra-1-81, which are specific surface antigens of embryonic stem cells, in the obtained clones.
[0085] 3. Results
[0086] The iPS cells produced in this experiment were positive for SSEA-3, SSEA-4, Tra-1...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com