Supercharge Your Innovation With Domain-Expert AI Agents!

Method for producing induced multipotential stem cell

A technology of pluripotent stem cells and cells, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as low efficiency, affecting application and promotion, and achieve high efficiency

Inactive Publication Date: 2009-10-07
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Low efficiency will seriously affect its application and promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing induced multipotential stem cell
  • Method for producing induced multipotential stem cell
  • Method for producing induced multipotential stem cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Preparation of Example 1 Class Embryonic Stem Cells

[0057] Coding regions of specific genes (Oct4, Nanog, Sox2, Lin28, c-myc, and Klf4) were amplified by polymerase chain reaction (PCR) from total human cDNA, and ligated into lentiviral vectors (construct like Figure 7 Shown, Invitrogen Company), so that it can be brought into cells by the produced lentivirus for expression. Oct-4 (also known as Oct-3, Pou5F1), GenBank accession number is NM_002701; Nanog, GenBank accession number is NP_079141; Sox2, GenBank accession number is NP_003097; Lin28, GenBank accession number is NP_078950; is NP_002458; Klf4, GenBank accession number is NP_004226. Amplification primers are listed in Table 1:

[0058] Table 1

[0059] Primer name

Primer sequence

lin28 5' primer SEQ ID NO: 1

atgggctccgtgtccaaccag

lin28 3' primer SEQ ID NO: 2

tcaattctgtgcctccggggag

C-myc 5' primer SEQ ID NO: 3

atgcccctcaacgttagcttca

C-myc 3' primer SEQ ...

Embodiment 2

[0073] The mensuration of embodiment 2 alkaline phosphatase

[0074] 1. Purpose: To identify whether the formed clone has the characteristics of embryonic stem cells by detecting the activity of alkaline phosphatase, and compare the results of the two experimental groups

[0075] 2. Method

[0076] For the experimental group transferred with 4 factors in Example 1, clones were picked on the 26th day; while for the experimental group transferred with 6 factors, clones were picked on the 17th day, which is called iPS-S. The selected clones were cultured on mouse embryonic fibroblast trophoblasts using standard human embryonic stem cell culture media and methods (Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts.Science.Nov 61998; 282(5391):1145-1147) In order to quantify the efficiency of reprogramming, we selected a flask of cells in each experiment and fixed them on day 17, and detected their alkaline phosphate Enzyme ...

Embodiment 3

[0081] The determination of embodiment 3 specific surface antigen

[0082] 1. Purpose: To further identify whether the obtained clone has the characteristics of embryonic stem cells by detecting whether it has the specific surface antigen of embryonic stem cells.

[0083] 2. Method

[0084] Using literature (Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts. Science. Nov 6 1998; 282(5391): 1145-1147 and Xiao L, YuanX, Sharkis SJ. Activin A Maintains self-renewal and regulates fibroblast growth factor, Wnt, andbone morphogenic protein pathways in human embryonic stem cells.Stem Cells.Jun2006; 24 (6): 1476-1486), respectively detect the embodiment by immunofluorescence 1 The expression of SSEA-3, SSEA-4, Tra-1-60, and Tra-1-81, which are specific surface antigens of embryonic stem cells, in the obtained clones.

[0085] 3. Results

[0086] The iPS cells produced in this experiment were positive for SSEA-3, SSEA-4, Tra-1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing induced multipotential stem cell, comprising steps of: A) constructing viral vectors carrying transcription factors, wherein the transcription factors are selected from: Oct4, Sox2, c-Myc, Klf4, Lin28 and Nanog; B) respectively transfecting viral vectors obtained in step A), and obtaining virus liquid containing the transcription factors; and C) infecting cells in combination manner by the virus liquid containing the transcription factors obtained from step B)selecting clones with human embryo like stem cell for subculturing, and obtaining induced multipotential stem cell by screening cell clone according to human embryo stem cell characteristic. The method of the invention for preparing human embryo stem cell has high efficiency, can avoid rejection reaction, differentiates to be different histiocytes in specific condition, and has an extensive application future.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a method for preparing induced pluripotent stem cells (Induced pluripotent stem cells, referred to as iPS cells). Background technique [0002] Human embryonic stem cells have the potential to differentiate into various types of human cells, and provide the possibility of application for regenerative medicine (Thomson JA., Itskovitz-Eldor J., Shapiro SS., et al.Science.Nov 6 1998; 282( 5391): 1145-1147). However, immune rejection has a great influence on the transplantation therapy of human embryonic stem cells. In order to be able to cultivate patient-specific pluripotent stem cells to eliminate the impact of immune rejection, people have tried many methods, such as nuclear transfer of adult cells (also known as therapeutic cloning), fusion of adult cells and human embryonic stem cells, etc. , but were not successful. The possibility of obtaining patient-specific induce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/86C12N15/867C12N5/10C12R1/93A61K35/545C12N15/11
Inventor 肖磊廖婧吴昭
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More