Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof
A hsa-mir-122, detection method technology, applied in the field of medical biological detection, can solve problems such as not seen, and achieve the effect of simple preparation method, convenient use, and high detection accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1: prepare test kit of the present invention (for one person's use)
[0040] The kit of the present invention consists of the following:
[0041] 1. 1 tube of reverse transcription primer, 100 μl / tube Concentration: 10 μM The reverse transcription primer is:
[0042] GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGCA
[0043] ATTGCACTGGATACGACCAAACA
[0044] 2. One tube of upstream and downstream primers for Real-time PCR, 100 μl / tube Concentration: 10 μM;
[0045] The upstream primer is: GCGTGGAGTGTGACAATGG
[0046] The downstream primer is: AGTGCGAACTGTGGCGAT
[0047] 3.Trizol reagent 1 tube 2000μl / tube
[0048] 4. Chloroform 1 tube 500μl / tube
[0049] 5. Absolute ethanol 1 tube 7ml / tube
[0050] 6. DEPC H 2 O 1 tube 1000μl / tube
[0051] 7. dd H 2 O 1 tube 2000μl / tube.
[0052] The present invention finds the mature body sequence UGGAGUGUGACAAUGGUGUUUG of hsa-mir-122 according to the known bioinformatics, and its specific reverse transcription prim...
Embodiment 2
[0065] Embodiment 2: the detection of kit of the present invention
[0066] 1. Collection of plasma samples and sample preparation:
[0067] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of chronic hepatitis biomarkers from plasma can improve the prognosis of chronic hepatitis to cirrhosis to a new level, so as to achieve early prevention and early treatment the goal of.
[0068] Plasma samples were collected in the inpatient department of Shanghai Changhai Hospital: 25 cases of moderate chronic hepatitis B patients (male: 18 cases, female: 7 cases), 28 cases of chronic hepatitis B severe patients (male: 20 cases, female: 8 cases), 25 cases of hepatitis B combined Liver cirrhosis (compensated stage) patients (male: 21 females: 4 cases), 25 cases of hepatitis B combined liver cirrhosis (decompensated stage) patients (male: 15 females: 4 cases), healthy control group 10 healthy blood donations members (male:...
Embodiment 3
[0089] Example 3: Comparison of hsa-mir-122 content in peripheral blood plasma of healthy people
[0090] It has been reported in the literature that in the peripheral blood of healthy people, the miRNA content is very stable, and in terms of gender, the difference between men and women is very small (see literature: Chen X, Ba Y, Ma L, et al.Characterization ofmiRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008; 18:997-1006). Before comparing the miRNA content in the patient's peripheral blood plasma, according to the same method as in Examples 1 and 2, a comparison was made to the amount of hsa-mir-122 in the plasma of healthy people, a total of 10 cases (male: 6 examples, female : 4 cases) (see figure 1 ). The results of Real-time PCR verified the statement in the literature that the miRNA content in the peripheral blood of healthy people remained basically stable.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com