Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof

A hsa-mir-122, detection method technology, applied in the field of medical biological detection, can solve problems such as not seen, and achieve the effect of simple preparation method, convenient use, and high detection accuracy

Inactive Publication Date: 2009-10-14
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] So far, there is no report on a kit for detecting the hsa-mir-122 content in plasma or serum to early predict the development of chronic hepatitis B into cirrhosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof
  • Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof
  • Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1: prepare test kit of the present invention (for one person's use)

[0040] The kit of the present invention consists of the following:

[0041] 1. 1 tube of reverse transcription primer, 100 μl / tube Concentration: 10 μM The reverse transcription primer is:

[0042] GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGCA

[0043] ATTGCACTGGATACGACCAAACA

[0044] 2. One tube of upstream and downstream primers for Real-time PCR, 100 μl / tube Concentration: 10 μM;

[0045] The upstream primer is: GCGTGGAGTGTGACAATGG

[0046] The downstream primer is: AGTGCGAACTGTGGCGAT

[0047] 3.Trizol reagent 1 tube 2000μl / tube

[0048] 4. Chloroform 1 tube 500μl / tube

[0049] 5. Absolute ethanol 1 tube 7ml / tube

[0050] 6. DEPC H 2 O 1 tube 1000μl / tube

[0051] 7. dd H 2 O 1 tube 2000μl / tube.

[0052] The present invention finds the mature body sequence UGGAGUGUGACAAUGGUGUUUG of hsa-mir-122 according to the known bioinformatics, and its specific reverse transcription prim...

Embodiment 2

[0065] Embodiment 2: the detection of kit of the present invention

[0066] 1. Collection of plasma samples and sample preparation:

[0067] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of chronic hepatitis biomarkers from plasma can improve the prognosis of chronic hepatitis to cirrhosis to a new level, so as to achieve early prevention and early treatment the goal of.

[0068] Plasma samples were collected in the inpatient department of Shanghai Changhai Hospital: 25 cases of moderate chronic hepatitis B patients (male: 18 cases, female: 7 cases), 28 cases of chronic hepatitis B severe patients (male: 20 cases, female: 8 cases), 25 cases of hepatitis B combined Liver cirrhosis (compensated stage) patients (male: 21 females: 4 cases), 25 cases of hepatitis B combined liver cirrhosis (decompensated stage) patients (male: 15 females: 4 cases), healthy control group 10 healthy blood donations members (male:...

Embodiment 3

[0089] Example 3: Comparison of hsa-mir-122 content in peripheral blood plasma of healthy people

[0090] It has been reported in the literature that in the peripheral blood of healthy people, the miRNA content is very stable, and in terms of gender, the difference between men and women is very small (see literature: Chen X, Ba Y, Ma L, et al.Characterization ofmiRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008; 18:997-1006). Before comparing the miRNA content in the patient's peripheral blood plasma, according to the same method as in Examples 1 and 2, a comparison was made to the amount of hsa-mir-122 in the plasma of healthy people, a total of 10 cases (male: 6 examples, female : 4 cases) (see figure 1 ). The results of Real-time PCR verified the statement in the literature that the miRNA content in the peripheral blood of healthy people remained basically stable.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medical bio-detection and relates to a kit used for detecting the content of hsa-mir-122 in blood plasma or blood serum to early predict hepatocirrhosis developed from chronic hepatitis B and a detection method thereof. At present, there is not existed any effective method for predicting hepatocirrhosis developed from chronic hepatitis B, which brings inconvenience for early prediction and treatment clinically. By comparing health crowd with patients with chronic hepatitis B and comparing the contents of hsa-mir-122 in blood plasma between the patients with chronic hepatitis B in four different disease conditions, the invention finds that the change of the content of has-mir-122 can be used as a means of early prediction of the hepatocirrhosis developed from chronic hepatitis B. The invention provides a kit for detecting the hsa-mir-122 to predict hepatocirrhosis developed from chronic hepatitis B. The kit comprises reverse transcription primer, upstream and downstream primers of Real-time PCR and an amplification system and the like; by clinical trial, the accuracy rate of detection is up to about 85 percent, therefore, the kit can be used for early prediction of hepatocirrhosis developed from chronic hepatitis B.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, and is a kit for detecting the content of hsa-mir-122 in plasma or serum to early predict the development of chronic hepatitis B into cirrhosis, and a detection method thereof. Background technique [0002] Chronic hepatitis B is a chronic infectious disease caused by hepatitis B virus (HBV) infection, which can easily develop into liver cirrhosis and liver cancer. There are about 2 billion people in the world who have ever been infected with hepatitis B virus, and there are currently about 350 million chronic hepatitis B virus carriers, and 70% of them are in our Asian region. [0003] Liver cirrhosis is a chronic disease characterized by diffuse fibrosis, pseudolobules and regenerative nodules in liver tissue, and is a serious outcome of chronic hepatitis B. If it can block, alleviate or even reverse the further progression of chronic hepatitis B Development can improve th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 孙树汉张毅贾音费明钰
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com