Manually reformed and compounded glyphosate-resistant gene and application thereof
A glyphosate-resistant and fusion gene technology is applied in the application, use of vectors to introduce foreign genetic material, and cells modified by introducing foreign genetic material. It can solve the problem of low expression efficiency and achieve significant herbicide resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Optimization and synthesis of embodiment 1BHR2 gene
[0024] In the original gene codon usage, there is one CTA codon among the 47 codons encoding Leu, and nine GTG codons among the 43 codons encoding Ala. These 10 codons are rare codons in plants. The translation efficiency of gene expression in plants is adversely affected to a large extent. Moreover, the usage of 20 kinds of amino acid codons is very different from that of plants, especially cotton codons. Therefore, in Example 1, the sequence of the gene was optimized using the biological software DNA2. The synonymous modification was carried out to eliminate the commonly used enzyme cleavage sites. Replace the asparagine (AAT) on the second codon of the BHR2 gene with alanine (GCT), so that its 5' end contains an Nco I site, and a SacI restriction site is added to the 3' end of the gene, It is convenient for the construction of subsequent vectors, and the gene sequence is shown in Table SEQ ID No: 1. The gene i...
Embodiment 2
[0028] Cloning of embodiment 2 chloroplast guide peptide gene
[0029] According to the sequence on NCBI, the cotton chloroplast guide peptide CTP gene was directly synthesized, and a BamHI restriction site was added to the 5' end of the gene, and a NcoI restriction site was added to the 3' end of the gene.
[0030] Codon analysis was carried out on the DNA sequences of ATP and PTP of the Arabidopsis and petunia green plastid guide peptide genes reported on NCBI, and the rare codons in APT and PTP were eliminated through synonymous substitutions, and the modified sequences were designed Synthetic primers AST1, AST2, AST3, AST4, AST5, AST6 and PST1, PST2, PST3, PST4, PST5, PST6, the primer sequences are as follows:
[0031] AST1: 5'GAGGATCCCTTATGGCCCAAGTTAGCAGAATCTGCAATGGTGTGCAGAACCCATCTC3'
[0032] AST2: 5'GGAGATTTTCGTTGACTGGATTTAGAGAGATTGGAGATAAGAGATGGGTTCTGCACAC3'
[0033] AST3: 5'TCCAGTCAACGAAAATCTCCCTTATCGGTTTCTCTGAAGACACAGCAGCATCCACGAG3'
[0034]AST4: 5'CACTCTTCTTCAATC...
Embodiment 3
[0061] The construction of embodiment 3 anti-glyphosate fusion gene plant expression vector
[0062] The vector containing the guide peptide sequence was digested with BamHI and Nco I to recover the target fragment, and constructed into the pUC57 vector containing the BHR2 gene treated with the same endonuclease, and the vectors pUCCTP-BHR2 and pUCATP containing three fusion genes were respectively obtained -BHR2 and pUCPTP-BHR2. Using the BamH I restriction site at the 5' end of the guide peptide sequence and the Sac I restriction site at the 3' end of the BHR2 gene, the three fusion genes were excised, recovered and constructed into the plant expression vector pBI121 treated with the same restriction enzymes, and the three fusion genes were obtained. The plant expression vectors pBI121-CTP-BHR2, pBI121-ATP-BHR2 and pBI121-PTP-BHR2 of a glyphosate-resistant integrated gene, the specific construction process is as follows image 3 , 4, 5.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More