Artificial sequence for increasing methionine content of soy and plant expression vector thereof
A technology for plant expression vectors and artificial sequences, which is applied in the field of artificial sequences and plant expression vectors, can solve problems such as poor stability, and achieve the effect of increasing the content of methionine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0011] Embodiment 1: The sequence of the artificial sequence HSSP for increasing soybean methionine content in this embodiment is as follows:
[0012] ATGGCTGCTAAGATGTTGGCTCTCTTCGCTCTCTTGGCTCTCTGCGCTTCAGCTACCTCAGCTACCCATATCCCTGGTCATCTCCCTCCTGTTATGCCCTTGGGAACCATGAACCCTTGCATGCAGTATTGCATGATGCAGCAGGGTCTCGCTTCACTCATGGCTTGCCCTTCTCTCATGCTCCAGCAGTTGCTCGCTCTCCCTCTCCAGACTATGCCTGTTATGATGCCTCAGATGATGACCCCTAACATGATGTCTCCTTTGATGATGCCTTCTATGATGTCTCCCATGGTTCTCCCTTCTATGATGTCTCAGATCATGATGCCTCAGTGCCATTGCGACGCTGTTTCTCAGATTATGTTGCAGCAGCAGTTGCCCTTCATGTTCAACCCTATGGCTATGACCATTCCTCCTATGTTCCTCCAGCAGCCCTTCGTTGGTGCTGCTTTCTAA。
specific Embodiment approach 2
[0013] Specific embodiment two: the difference between this embodiment and specific embodiment one is: the omega translation enhancer sequence and the plant translation initiation codon consensus sequence kozak are added upstream of the artificial sequence HSSP, and the mRNA tailing signal sequence and clipping sequence are added downstream of the artificial sequence HSSP. cut sequence. Other steps and parameters are the same as those in Embodiment 1.
[0014] The structural map of the artificial sequence that increases the content of soybean methionine in this embodiment is as follows figure 1 shown.
[0015] This embodiment carries out prokaryotic expression test:
[0016] The artificial sequence for increasing soybean methionine content in this embodiment is constructed on the prokaryotic expression vector pET-32b, and transformed into Escherichia coli BL21 (DE3). Use liquid LB medium to activate Escherichia coli BL21 (DE3 pET-32b) and 3 strains of BL21 (DE3 pET-32b-HSSP...
specific Embodiment approach 3
[0018] Specific embodiment three: the plant expression vector of the artificial sequence that improves soybean methionine content in this embodiment includes artificial sequence HSSP, and the upstream of the artificial sequence HSSP of the plant expression vector includes the E12 enhancer sequence and the seed-specific expression promoter Pgy2, and the artificial sequence HSSP of the plant expression vector Downstream contains the Tnos terminator sequence.
[0019] Specific implementation mode four: combination image 3 Illustrate this embodiment, this embodiment constructs the plant expression vector of the artificial sequence that improves soybean methionine content according to the following steps:
[0020] 1. Digest the plasmid pUH with Xba I and Sac I to recover the 640bp fragment;
[0021] 2. Simultaneously use Xba I and Sac I to double-digest the vector cassette pBEGT to recover large fragments of DNA;
[0022] 3. Connect the two fragments recovered in step 1 and step...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 