Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof

A technology of pyruvyl shikig and phosphate synthase, which is applied in the field of microbial genetic engineering and can solve problems such as affecting crop growth and crop destruction.

Inactive Publication Date: 2010-09-15
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glyphosate is a relatively mild herbicide with low damage to the environment, but while it kills weeds, it also has a destructive effect on crops and affects the growth of crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof
  • Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof
  • Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1: Obtaining the full sequence of the EPSPS coding gene of Bacillus pallidum

[0019] In the present invention, a strain of Paleobacter hominis is isolated and obtained from soil samples collected around the Nalati grassland in Xinjiang, which is named as P23. The EPSPS-encoding gene was cloned from this strain by homologous cloning.

[0020] 1. Genome extraction method: genome use The company's bacterial genomic DNA extraction kit was used for extraction, see its instructions for details.

[0021] 2. PCR amplification method

[0022] Two oligonucleotide primers were designed based on the full-length EPSPS gene sequence of Ochrobacrum anthorpi in NCBI (accession number CP000758), and the full EPSPS coding sequence of P23 was obtained by PCR amplification.

[0023] The primers are as follows:

[0024] p23F: 5'-ATGTCCCATTCTGCACCCCCGAAAC-3'

[0025] (as shown in SEQ ID No.3)

[0026] p23R: 5'-TCATCGCGCGTCGCTCAGTTCGAT-3'

[0027] (as shown in SEQ ID No.4)

...

Embodiment 2

[0052] Example 2: aroA P23 Recombination with cloning vector pUC18 and transformation of E. coli JM109

[0053] 1. PCR amplification method

[0054] According to the sequencing results of Example 1, primers were redesigned, and PCR amplification was performed from the P23 genome.

[0055] The primers are as follows:

[0056] p23F-BamH I CGGGATCCATGTCCCATTCTGCACCCCCGAAAC

[0057] (as shown in SEQ ID No.5)

[0058] p23R-SalI ACGCGTCGACTCATCGCGCGTCGCTCAGTTCGAT

[0059] (as shown in SEQ ID No.6)

[0060] PCR reaction conditions are as follows:

[0061] Sterilized distilled water 20.5μl

[0062] 2×Buffer 25μl

[0063] dNTPs (10mmol) 1μl

[0064] PrimeSTAR HS 0.5μl

[0065] P23F-BamHI (10pmol) 1μl

[0066] P23R-SalI-1 (10pmol) 1μl

[0067] DNA 1ul (50ng)

[0068]

[0069] 50μl

[0070] The PCR reaction program is as follows:

[0071] 98℃ 5min

[0072]

[0073] 4℃ forever

[0074] After the PCR amplification produ...

Embodiment 3

[0091] Example 3: P23EPSP synthase complementation experiment

[0092] 1. Experimental method:

[0093] The recombinant vector pUC18-P23 obtained in Example 2 was heat-shock transformed into EPSPS-deficient E. coli strain ER2799, and the obtained strain was named ER-pUCP23. The cloned strain ER-pUCP23, which was verified to be correct by sequencing, was spread on the M9 solid plate. At the same time, ER2799 and ER2799 transfected with empty pUC18 were used as controls.

[0094] 2. Results:

[0095] The P23 gene has the function of encoding the complete EPSPS.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase (EPSPS). The EPSPS has an amino acid sequence shown as SEQ ID No.2, the gene has the amino acid sequence shown as SEQ ID No.1, and the gene is obtained by cloning from the strain of an ochrobactrum anthropi obtained by separating a soil sample collected at the periphery of a Nalati grassland in Xinjiang by a homologous cloning method. Through an experiment of glyphosate resistance, the gene is found to have good glyphosate resistance and is an excellent gene in the genes of the same kind. The invention also provides a cloning vector and an expression vector thereof which are used for biotransformation and used for transforming crops, thereby the purpose of resisting a herbicide by plants is achieved.

Description

technical field [0001] The invention relates to the field of microbial genetic engineering, in particular to the cloning and application of a glyphosate resistance coding gene. Background technique [0002] In agricultural production, field weeds are regularly removed to prevent them from competing with crops for fertilizer. Compared with manual weeding, spraying herbicides can reduce labor intensity, reduce labor costs and increase grain yield. There are many kinds of herbicides, with strong or weak toxicity and different targets. Glyphosate is a relatively mild herbicide with low environmental damage, but while killing weeds, it also has a destructive effect on crops and affects the growth of crops. In order to get rid of weeds in a targeted manner, farmers often use several herbicides with strong toxicity. Transforming crops into a glyphosate-resistant gene allows crops to produce an enzyme that can resist the damaging effects of glyphosate under the guidance of this g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10A01H5/00
Inventor金芜军林敏宛煜嵩李海红
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI