Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof
A technology of pyruvyl shikig and phosphate synthase, which is applied in the field of microbial genetic engineering and can solve problems such as affecting crop growth and crop destruction.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Example 1: Obtaining the full sequence of the EPSPS coding gene of Bacillus pallidum
[0019] In the present invention, a strain of Paleobacter hominis is isolated and obtained from soil samples collected around the Nalati grassland in Xinjiang, which is named as P23. The EPSPS-encoding gene was cloned from this strain by homologous cloning.
[0020] 1. Genome extraction method: genome use The company's bacterial genomic DNA extraction kit was used for extraction, see its instructions for details.
[0021] 2. PCR amplification method
[0022] Two oligonucleotide primers were designed based on the full-length EPSPS gene sequence of Ochrobacrum anthorpi in NCBI (accession number CP000758), and the full EPSPS coding sequence of P23 was obtained by PCR amplification.
[0023] The primers are as follows:
[0024] p23F: 5'-ATGTCCCATTCTGCACCCCCGAAAC-3'
[0025] (as shown in SEQ ID No.3)
[0026] p23R: 5'-TCATCGCGCGTCGCTCAGTTCGAT-3'
[0027] (as shown in SEQ ID No.4)
...
Embodiment 2
[0052] Example 2: aroA P23 Recombination with cloning vector pUC18 and transformation of E. coli JM109
[0053] 1. PCR amplification method
[0054] According to the sequencing results of Example 1, primers were redesigned, and PCR amplification was performed from the P23 genome.
[0055] The primers are as follows:
[0056] p23F-BamH I CGGGATCCATGTCCCATTCTGCACCCCCGAAAC
[0057] (as shown in SEQ ID No.5)
[0058] p23R-SalI ACGCGTCGACTCATCGCGCGTCGCTCAGTTCGAT
[0059] (as shown in SEQ ID No.6)
[0060] PCR reaction conditions are as follows:
[0061] Sterilized distilled water 20.5μl
[0062] 2×Buffer 25μl
[0063] dNTPs (10mmol) 1μl
[0064] PrimeSTAR HS 0.5μl
[0065] P23F-BamHI (10pmol) 1μl
[0066] P23R-SalI-1 (10pmol) 1μl
[0067] DNA 1ul (50ng)
[0068]
[0069] 50μl
[0070] The PCR reaction program is as follows:
[0071] 98℃ 5min
[0072]
[0073] 4℃ forever
[0074] After the PCR amplification produ...
Embodiment 3
[0091] Example 3: P23EPSP synthase complementation experiment
[0092] 1. Experimental method:
[0093] The recombinant vector pUC18-P23 obtained in Example 2 was heat-shock transformed into EPSPS-deficient E. coli strain ER2799, and the obtained strain was named ER-pUCP23. The cloned strain ER-pUCP23, which was verified to be correct by sequencing, was spread on the M9 solid plate. At the same time, ER2799 and ER2799 transfected with empty pUC18 were used as controls.
[0094] 2. Results:
[0095] The P23 gene has the function of encoding the complete EPSPS.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap