Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Papain antigenic epitope, antipain antibody and applications of papain antibody

A technology of papain and antigen epitope, which is applied in the fields of molecular biology and immunology, can solve the problems of inability to trigger immune response and inability to specifically represent antigens, etc., and achieve easy spatial conformation reproduction, simple antigen synthesis, and high accuracy Effect

Inactive Publication Date: 2011-01-19
BGI SHENZHEN CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although there are currently software for predicting antigenic epitopes, such as BEPITOPE software, about 30% of the predicted epitopes will be non-effective epitopes, that is, epitopes that cannot specifically represent antigens, or cannot Elicit immune response (Chang HT, Liu CH, Pai TW. Estimation and extraction of B-cell linear epitopes predicted by mathematical morphology approaches. J MolRecognit. 2008 Nov-Dec; 21(6): 431-41)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Papain antigenic epitope, antipain antibody and applications of papain antibody
  • Papain antigenic epitope, antipain antibody and applications of papain antibody
  • Papain antigenic epitope, antipain antibody and applications of papain antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Prediction of Candidate Epitope 1

[0045] The gene ID of the gene corresponding to rice papain in GenBank is: NP_001059639.1. The reading frame sequence is as follows:

[0046] ATGGCTGCTGCACCTGCACGGCTCGTCGTCCTTGTCCTCGTGGCGGTCGTCGTCGTCGTCGGCGGCGACGGCGACGCCGGCGTCATCCGGCAGGTGACGGACGGCGGGTACTGGCCGCCGGGGCTGCTCCCGGAGGCCCAGTTCGCGGCGTTCGTGCGGCGGCACGGGCGGGAGTACTCCGGGCCGGAGGAGTACGCGCGGCGGCTGCGCGTGTTCGCCGCCAACCTCGCCCGCGCCGCGGCGCACCAGGCGCTCGACCCGACCGCGCGCCACGGCGTCACCCCGTTCTCCGACCTCACCCGGGAGGAGTTCGAGGCGCGCTTGACGGGCCTCGCCGCCGACGTTGGCGACGACGTCCGGAGGCGGCCGATGCCGTCCGCCGCGCCGGCCACGGAGGAGGAGGTGTCCGGCCTCCCCGCCAGCTTCGACTGGCGTGACAGGGGCGCCGTGACCGACGTCAAGATGCAGGGCGCGTGCGGCTCCTGCTGGGCCTTCAGCACCACCGGCGCCGTCGAGGGCGCCAACTTCCTCGCCACCGGCAACCTCCTCGACCTCAGCGAGCAGCAGCTCGTCGACTGCGACCACACGTGCGACGCGGAGAAGAAGACGGAGTGCGACAGCGGGTGCGGCGGCGGGCTGATGACGAACGCCTACGCCTACCTGATGAGCTCGGGGGGGCTGATGGAGCAGAGCGCGTACCCATACACGGGCGCGCAGGGGACGTGCCGGTTCGACGCCAACCGGGTCGCCGTCCGCGTCGCCAACTTCACCGTCGTCGCGCCGCCGGGCGGCAACG...

Embodiment 2

[0052] Example 2: Chemical Synthesis of Epitope 1

[0053] There is no cysteine ​​at both ends of the candidate epitope 1 obtained in Example 1. In order to achieve cross-linking with the carrier, cysteine ​​needs to be added to the synthesized sequence, so the polypeptide sequence to be synthesized is: C HGVTPFSDLTREE (SEQ ID NO: 6).

[0054] The polypeptide sequence shown in SEQ ID NO: 6 was chemically synthesized (synthesized by Jill Biochemical Co., Ltd.) to obtain epitope 1 of papain.

Embodiment 3

[0055] Example 3: Preparation of antigenic epitope 1-KLH complex

[0056] Using the glutaraldehyde linkage method, the N-terminal of the epitope 1 synthesized in Example 2 was cross-linked with the cross-linking carrier protein-keyhole limpet hemocyanin (KLH) to obtain the epitope 1-KLH complex.

[0057] The specific implementation steps are as follows:

[0058] Add 5 mg of synthetic peptide to 7 mg of KLH, slowly add 1 ml of freshly prepared 3 g / L glutaraldehyde solution while shaking, and incubate at room temperature for 2 h. Dialyzed with pH 8.5 boric acid buffer for 24 hours to obtain epitope 1-KLH complex.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the molecular biology field and immunology field and relates to a papain antigenic epitope, an antipain antibody and the applications of the papain antibody. Specifically, the papain antigenic epitope has the sequences shown in the SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO:6. The invention also relates to an antipain polyclonal antibody, and the polyclonal antibody is specifically bound with the above antigenic epitope. The polyclonal antibody has high specificity and titer. The invention also relates to a preparation method and applications of the polyclonal antibody, a composite containing the polyclonal antibody and a detection method of the papain.

Description

technical field [0001] The present invention belongs to the fields of molecular biology and immunology. Specifically, it relates to a papain epitope, anti-papain antibody. The present invention also relates to a composition containing the antigen epitope or antibody, and the use of the antibody in detecting papain. Background technique [0002] Papain (enzyme classification number EC: 3.4.2 2) belongs to cysteine ​​proteases (Cysteine ​​proteases, CPs) and is also an important proteolytic enzyme. Papain is ubiquitous in various organisms and has a conserved structure in human, dog, cow, mouse, rat, zebrafish, Drosophila, mosquito, nematode, Arabidopsis and rice (SEQ ID NO: 1) . [0003] Studies have found that papain usually exists in the cell in the form of zymogen, is activated by intramolecular or intermolecular proteolysis, and catalyzes the polypeptide chain through the sulfhydryl group of the cysteine ​​residue in its active center as a nucleophile. The hydrolysis ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/08C07K14/795C07K14/765C07K14/47C07K16/40C07K16/06G01N33/577G01N33/573
Inventor 林梁侯明明王宪云白辉陈创彬
Owner BGI SHENZHEN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com