Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of SJ16 protein in preparing immunosuppressive drugs

1. The technology of SJ16 and immunotherapy drugs, which is applied in the direction of drug combinations, peptide/protein components, anti-tumor drugs, etc., can solve problems such as SJ16 research, achieve a broad market space, and avoid toxic and side effects

Active Publication Date: 2013-04-24
SUN YAT SEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no one has studied the immunosuppressive effect of SJ16

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SJ16 protein in preparing immunosuppressive drugs
  • Application of SJ16 protein in preparing immunosuppressive drugs
  • Application of SJ16 protein in preparing immunosuppressive drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Primers were designed according to the gene sequence of Schistosoma japonicum SJ16, analyzed by PCRDESIGN software, and synthesized by Shanghai Sangon Bioengineering Co., Ltd. Primer P1 was 5'GCCATATGAACATGACTTTAATTAAC, and NdeI restriction site was introduced; primer P2 was 5'ACTTAATACTTTGTAGAATTCGAACC, and HindIII restriction site was introduced . The full-length SJ16 gene was amplified.

Embodiment 2

[0025] Expression, identification and purification of full-length SJ16

[0026] Amplified successfully with the designed pair of primers (P1, P2). It was cloned into the pGEX-4T-1 vector, and the DNA of the pGEX-4T-1-Sj16-1 recombinant plasmid screened was picked, and used as a template, and the specific bands obtained by PCR amplification were performed with P1 and P2 primers. band; double-enzyme digestion verified that its size was consistent with the expected sequence; the screened recombinant plasmid was sent to TaKaRa Company for sequencing, and the sequencing result was correct. The obtained recombinant plasmid was indeed pGEX-4T-1-Sj16-1 recombinant plasmid. After the engineered bacteria transformed with the pGEX-4T-1-Sj16-1 recombinant plasmid were induced and expressed by IPTG, 15% SDS-PAGE electrophoresis showed that an obvious protein band appeared at a molecular weight of about 46kDa, while the transformed bacteria with the empty plasmid were induced before and af...

Embodiment 3

[0030] Expression and Identification of SJ16-1, SJ16-2, Sj16-3

[0031]According to the protein sequence of SJ16-1, the corresponding DNA sequence was directly synthesized and named as SJ16-1 sequence. According to the flexible arm (-GGAGGA-) introduced between SJ16-2 and SJ16-3, SJ16-2 and SJ16-3 are fused; then the corresponding nucleic acid sequence is designed according to its protein sequence. They were respectively cloned into the pGEX-4T-1 vector, and the pGEX-4T-1-Sj16-1, pGEX-4T-1-Sj16-2, pGEX-4T-1-Sj16-3 recombinant plasmids selected DNA, using it as a template, and using the corresponding primers to amplify the specific band obtained by PCR; double enzyme digestion to verify that its size is consistent with the expected sequence; send the screened recombinant plasmid to TaKaRa Company for sequencing, and the sequencing result is correct. The obtained recombinant plasmids were indeed pGEX-4T-1-Sj16-1 and pGEX-4T-1-Sj16-2-3 recombinant plasmids. After the engineerin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an application method of SJ16 protein in preparing immunosuppressive drugs. The necessary constitutive polypeptide sequences of the drugs comprise SJ16 protein, or an active fragment SEQ IDNO:1 or SEQ ID NO:2 or SEQ ID NO:3 sequence of the SJ16 protein, or one or more of functional variants with more than 70% of identity with above proteins. In the invention, SJ16 is applied to preparing the immunosuppressive drugs for the first time. Compared with similar drugs, the prepared drugs of the invention have the advantages of low toxicity and high efficiency as the drugs come from a pathogen biological resource, i.e. natural Schistosoma protein, thereby having good social and economic benefits.

Description

technical field [0001] The invention relates to the field of biopharmaceuticals, in particular to a novel immunosuppressive drug. Background technique [0002] Immunosuppressant (Immunosuppressant, ISA) is a class of drugs with immunosuppressive effect, the main function is to suppress the abnormal immune response of the body, so as to achieve the purpose of treating autoimmune diseases, anti-tumor, and anti-organ transplant rejection. The main mechanism of action of immunosuppressants is to reduce the immune response of the body by inhibiting the proliferation and function of cells related to immune response (immune cells such as T cells and B cells). Immunosuppressants can be roughly divided into four generations. The first generation is represented by adrenal cortex hormone, tripterygium glycosides tablets, azathioprine and anti-lymphocyte globulin; the second generation is represented by cyclosporine and tacrolimus; the third generation is represented by the monoclonal ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435A61K38/17A61P37/06A61P35/00
CPCY02A50/30
Inventor 孙希卞国武阮志燕胡少敏杨琳琳刘灵辉吕志跃吴忠道
Owner SUN YAT SEN UNIV