Recombinant adenovirus vaccine containing EB (Epstein-Barr) virus membrane protein gp350/220, gp85, gp78 or gp25 gene

A technology of recombinant adenovirus and EB virus, applied in the field of or gp2, can solve the problems of difficulty in scale, limited production of natural gp350, etc., and achieve the effects of various and convenient use forms, prevention of virus infection, and convenient use.

Inactive Publication Date: 2011-06-29
SUN YAT SEN UNIV CANCER CENT
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the output of extracting natural gp350 is limited after all, and it is not easy to scale up

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus vaccine containing EB (Epstein-Barr) virus membrane protein gp350/220, gp85, gp78 or gp25 gene
  • Recombinant adenovirus vaccine containing EB (Epstein-Barr) virus membrane protein gp350/220, gp85, gp78 or gp25 gene
  • Recombinant adenovirus vaccine containing EB (Epstein-Barr) virus membrane protein gp350/220, gp85, gp78 or gp25 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] In this application, unless otherwise specified, the implementation of the present invention uses conventional techniques of molecular biology, molecular biology, recombinant DNA and immunology, which are all conventional techniques mastered by those skilled in the art. These techniques are described in detail in the following documents: Molecular Cloning: Alaboratory Manual, 2nd Edition (1989), edited by Sambrook et al.; Nucleic Acid Hybridization (edited by B.D.Hames and S.J. Higgin, 1984); Immnochemical Methods in Cell And Molecular Biology (Academic Press , London).

[0041] Materials and methods:

[0042] Epstein-Barr virus strain GD1 derived from nasopharyngeal carcinoma tissue used in the present invention (established by our laboratory, JOURNALOF VIROLOGY, Dec.2005, p.15323-15330);

[0043] Adenovirus shuttle plasmid pENTR2B, adenovirus backbone plasmid, Escherichia coli host cell JM109 and adenovirus packaging cells were purchased from INVITROGEN, USA.

[004...

Embodiment 1

[0049] Example 1: Construction of a recombinant adenoviral vector containing Epstein-Barr virus glycoprotein gp350 / 220 gene sequence

[0050] 1.1 Construction of the shuttle plasmid

[0051] According to the EBV membrane protein gp350 / 220 gene sequence published by the gene bank (gene bank query number AY961628.3), the PCR primers were designed as follows:

[0052] Upstream primer P1: TTGAGTCGACACCATGGAGGCAGCCTTGCTTGT;

[0053] Downstream primer P2: TCAGGAGAGGTTTGAGAATCTGG;

[0054] The PCR reaction system is: deionized water ddH2O 16.3uL, PCR Buffer2.5uL, upstream primer P1: 0.5uL, downstream primer P2: 0.5uL, dNTP4.0uL, Taq enzyme: 0.2ul, CD1 template 1uL, a total of 25U1. Use ddH2O instead of the template as a negative control.

[0055] The PCR reaction conditions are: 95°C, 5min denaturation; 95°C, 30s, 55°C, 45s, 72°C, 1min, a total of 30 cycles, 72°C, 7min. Check the PCR products on an agarose gel, see figure 1 .

[0056] The PCR product was recovered by electropho...

Embodiment 2

[0092] 2.1 Construction of the shuttle plasmid

[0093] According to the EBV membrane protein gp85 gene sequence published by the gene bank (gene bank query number GPAY96162.8), the PCR primers were designed as follows:

[0094] Upstream primer P3: ACCGTCGACATGGGCCAGTTGCTCTGTGTTTTTTGC;

[0095] Downstream primer P4: TCAGTGTGCCTCTTTCTTCATACAG;

[0096] The PCR reaction system is: deionized water ddH2O 16.3uL, PCR Buffer 2.5uL, upstream primer PI: 0.5uL, downstream primer P2: 0.5uL, dNTP 4.0uL, Taq enzyme: 0.2uL, CD1 template 1uL, a total of 25uL. Use ddH2O instead of the template as a negative control.

[0097] The PCR reaction conditions are: 95°C, 5min denaturation; 95°C, 30s, 55°C, 45s, 72°C, 1min, a total of 30 cycles, 72°C, 7min. The length of the fragment amplified by PCR is 2200bp; (please supplement) see figure 1

[0098] The PCR product was recovered by electrophoresis using an agarose gel method to obtain PCR product 1. For recovery steps, see the manual of Mine...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of biological gene engineering and biomedicine, and particularly relates to a replication-deficient recombinant adenovirus vector containing EB (Epstein-Barr) virus membrane protein gp350 / 220, gp85, gp78 or gp25 gene and a preparation method thereof. The replication-deficient recombinant adenovirus vector containing EB virus membrane protein 350 / 220 of gp, 85 of gp, 78 of gp or 25 of gp gene can be used for developing vaccines and medicaments for treating and / or preventing nasopharyngeal carcinoma.

Description

technical field [0001] The invention belongs to the field of biogenetic engineering and biomedicine, and in particular relates to a replication-deficient recombinant adenovirus containing Epstein-Barr virus membrane protein gp350 / 220, gp85, gp78 or gp25 gene and a preparation method thereof, and an Epstein-Barr virus glycoprotein gp350 / The antigen-presenting cells transduced by 220-gene replication-deficient recombinant adenovirus vectors and the vaccine composition containing the antigen-presenting cells also relate to the use of the vaccine composition in the prevention and treatment of nasopharyngeal carcinoma. Background technique [0002] Epstein-Barr virus (EBV) was first discovered by Epstein and Barr in 1964 from primary cultured cells of Burkitt lymphoma in Africa. Epstein-Barr virus (EBV) is a herpes virus (herpsvirus) widely present in the population, and more than 90% of people have established latent EBV infection for life. In addition to directly causing infe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N7/01C12N15/38C12N15/861A61K39/245A61K48/00A61P31/20A61P35/00A61P11/02C12R1/19C12R1/93
Inventor曾益新吕小斌熊耿谢彦博
OwnerSUN YAT SEN UNIV CANCER CENT