33 results about "Epstein barr" patented technology

The invention discloses a nasopharyngeal carcinoma targeted magnetic resonance contrast agent and a preparation method thereof. The method comprises the following steps: synthesizing superparamagnetic Fe3O4 with grain diameter of between 10 and 15nm by adopting a chemical coprecipitation method, coating with APTES ((3-aminopropyl)triethoxysilane) or connecting superparamagnetic Fe3O4 to 10-15nm Fe3O4 to carry out surface amination on Fe3O4 to obtain Fe3O4-APTES surface-modified micro-particles; and connecting Fe3O4-APTES and EB (Epstein-Barr) virus latent membrane protein 1 monoclonal antibody (LMP1, Clone CS.1-4) with polyethylene glycol (PEG) as a connecting arm to obtain Fe3O4-APTES-PEG-LMP1, Clone CS.1-4 colloidal solution with stable dispersion. Compared with a conventional contrast agent, the contrast agent has the advantages of low toxicity, high stability, good biocompatibility, high sensitivity and good specific targeting property to LMP1<+>-nasopharyngeal carcinoma, and can be used for nasopharyngeal carcinoma screening and specific magnetic resonance diagnosis.

The invention relates to the technical fields of biotechnology, medical immunology and in vitro serological diagnosis, and particularly relates to an artificial antigen and a kit for joint detection of an Rta protein antibody of an epstein-barr (EB) virus and an early antigen ethyl acrylate (EA) antibody of the EB virus. The Rta protein antibody of the EB virus and the early antigen EA antibody existing in a to-be-detected sample can be accurately, efficiently, sensitively and specifically detected by the artificial antigen provided by the invention. By adopting the kit prepared from the artificial antigen, compared with the traditional detection method, the sensitivity and the specificity of nasopharynx cancer diagnosis are improved, the detection time is shortened, a patient can be timely treated, and the pain is relieved.

The invention discloses a reaction carrier and a kit for detecting an Epstein Barr (EB) virus replication and transcription activator (Rta)-immunoglobulin G (IgG) antibody. The reaction carrier for immunological detection of the EB virus Rta-IgG antibody is coated with gene recombinant EB virus Rta protein, and the gene recombinant EB virus Rta protein is obtained by expression of Chinese hamster ovary (CHO) cell line CHO / RTA with the preservation number of China General Microbiological Culture Collection Center (CGMCC) 6955. The kit comprises the reaction carrier. Clinical experiments show that the kit for the quantitative detection of the EB virus Rta-IgG is easy and convenient to operate, high in sensitivity and good in specificity.

The invention relates to a medical application of EB (Epstein-Barr) virus miR-BART3 antisense oligonucleotides, in particular relating to an application of EB virus miR-BART3 antisense oligonucleotides in preparing a medicament for treating nasopharyngeal darcinoma, wherein the sequence of the EB virus miR-BART3 antisense oligonucleotides is ACACCUGGUGACUAGUGGUGCG (SEQ ID NO:1). The EB virus miR-BART3 antisense oligonucleotides can be effectively combined with mature miRNA of the EB virus to block the expression of the miRNA and corresponding regulation action thereof, thus restraining the invasion and metastasis of nasopharyngeal darcinoma cells; and the miRNA has no immunogenifcity, thus being favorable for being further applied in preventing the recurrence and metastasis of the nasopharyngeal darcinoma. The medicament can be used for protecting the antisense oligonucleotides from being degraded by nuclease and prolonging the action time, has higher transfection effciciency than that of commodity liposome, and is favorable for further practical clinical development and application.

The invention relates to a medicine application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide, in particular to an application of EB virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer. The antisense oligonucleotide has a sequence of CCCUGGACACUGGACUAUGAUG (SEQ ID NO:1). The antisense oligonucleotide disclosed by the invention can be effectively combined with the mature mi ribonucleic acid (RNA) of the EB virus to block EB virus miR-BART7 expression and the corresponding regulation action of the EB virus miR-BART7 so as to prevent the nasopharynx cancer cell from invading and transferring. The miRNA does not have immunogenicity and is favorable for further use for preventing the nasopharynx cancer from recurring and transferring. According to the medicine which embodies the application disclosed by the invention, the antisense oligonucleotide can be prevented from degrading by nuclease, the action time is prolonged, and the medicine has higher transfection efficiency than a commercial liposome and is favorable for further clinic practical development and application.

The invention provides an EB (epstein-barr) virus VCA / NA1-IgA antibody joint detection reagent. The EB virus VCA / NA1-IgA antibody joint detection reagent at least comprises a reaction membrane, an antigen pad and a gold label pad, wherein a detection line and a quality control line are labeled on the reaction membrane; the detection line contains a rat anti-human IgA monoclonal antibody; the quality control line contains biotin; the antigen pad contains a recombinant EB virus VCA antigen labeled with the biotin and a recombinant EB virus NA1 antigen labeled with the biotin; and the gold label pad contains an avidin compound containing a colloid gold label. The joint detection reagent provided by the invention is used for carrying out joint detection on VCA and NA1 so that the cost can be saved; the application and the popularization of the detection reagent are facilitated and the detection cost is reduced; and the EB virus VCA / NA1-IgA antibody joint detection reagent has the characteristics of rapidness, simplicity and convenience, accuracy and high sensitivity.

The invention relates to a medical immunodetection method and in particular relates to a method for detecting an EB (Epstein-Barr) virus by an immunological method by using a quantum dot labelled immunochromatographic test strip. The quantum dot labelled immunochromatographic test strip is characterized in that a glass cellulose membrane A, a glass cellulose membrane B of a quantum dot labelled EB virus IgA (immunoglobulin A) monoclonal antibody, a nitrocellulose membrane and absorbent paper are stuck to a plastic board from bottom to top in sequence, wherein one end of the nitrocellulose membrane is provided with an EB virus polyclonal antibody and a rabbit anti-mouse second antibody, thereby forming a detection zone T and a quality control zone C; the quantum dot labelled EB virus IgA monoclonal antibody is arranged at the other end of the glass cellulose membrane B, corresponds to the detection zone T and the quality control zone C and is arranged at one end of a sampling point. The detection sensitivity of the method is about 1000 times higher than that of the detection method frequently used at present.

The invention provides a method for detecting pathogenic microorganisms by using a PCR (polymerase chain reaction) enzyme-linked double-cross method, belongs to the technical field of clinical medical microorganism detection, and particularly relates to a synchronous qualitative and quantitative detection method for various microorganisms. In the method, DNA (deoxyribonucleic acid) amplification, DNA hybridization and enzyme-linked immunosorbent assay reaction are used, a solid-phase surface enveloping technology is adopted, a specificity conservative segment is amplified, an amplified product is combined to a capturing probe and is adsorbed to a solid-phase surface, far-end hybridization of an enzyme-linked probe is carried out, and a quantitative color product is generated by specific antibody recognition and reaction of enzyme and a substrate. The detected pathogenic microorganisms comprise EB (Epstein Barr) viruses, giant cell and cell viruses, herpes simplex viruses 1 and herpes simplex viruses 2. Various microorganisms of a clinical sample are detected simultaneously, and four types of viruses are screened by a reaction. The method has the advantages that the time and the cost are saved, application is flexible, the repeatability, the stability, the sensitivity and the specificity are high, and the method is simple and is easy to implement. Moreover, the method is suitable for widely detecting pathogenic microorganisms and is particularly suitable for a basic medical institution.