33 results about "Epstein barr" patented technology

The present invention relates to compositions comprising analogues of purine nucleosides containing a ring-expanded (“fat”) heterocyclic ring, in place of purine, and an unmodified or modified sugar residue, pharmaceutically acceptable derivatives of such compositions, as well as methods of use thereof. In particular, these compositions may be utilized in the treatment of certain cancers, bacterial, fungal, parasitic, and viral infections, including, but not limited to, Acquired Immunodeficiency Syndrome (AIDS), hepatitis, Epstein-Barr and cytomegalovirus.

The invention provides a method for detecting pathogenic microorganisms by using a PCR (polymerase chain reaction) enzyme-linked double-cross method, belongs to the technical field of clinical medical microorganism detection, and particularly relates to a synchronous qualitative and quantitative detection method for various microorganisms. In the method, DNA (deoxyribonucleic acid) amplification, DNA hybridization and enzyme-linked immunosorbent assay reaction are used, a solid-phase surface enveloping technology is adopted, a specificity conservative segment is amplified, an amplified product is combined to a capturing probe and is adsorbed to a solid-phase surface, far-end hybridization of an enzyme-linked probe is carried out, and a quantitative color product is generated by specific antibody recognition and reaction of enzyme and a substrate. The detected pathogenic microorganisms comprise EB (Epstein Barr) viruses, giant cell and cell viruses, herpes simplex viruses 1 and herpes simplex viruses 2. Various microorganisms of a clinical sample are detected simultaneously, and four types of viruses are screened by a reaction. The method has the advantages that the time and the cost are saved, application is flexible, the repeatability, the stability, the sensitivity and the specificity are high, and the method is simple and is easy to implement. Moreover, the method is suitable for widely detecting pathogenic microorganisms and is particularly suitable for a basic medical institution.

The invention discloses a nasopharyngeal carcinoma targeted magnetic resonance contrast agent and a preparation method thereof. The method comprises the following steps: synthesizing superparamagnetic Fe3O4 with grain diameter of between 10 and 15nm by adopting a chemical coprecipitation method, coating with APTES ((3-aminopropyl)triethoxysilane) or connecting superparamagnetic Fe3O4 to 10-15nm Fe3O4 to carry out surface amination on Fe3O4 to obtain Fe3O4-APTES surface-modified micro-particles; and connecting Fe3O4-APTES and EB (Epstein-Barr) virus latent membrane protein 1 monoclonal antibody (LMP1, Clone CS.1-4) with polyethylene glycol (PEG) as a connecting arm to obtain Fe3O4-APTES-PEG-LMP1, Clone CS.1-4 colloidal solution with stable dispersion. Compared with a conventional contrast agent, the contrast agent has the advantages of low toxicity, high stability, good biocompatibility, high sensitivity and good specific targeting property to LMP1<+>-nasopharyngeal carcinoma, and can be used for nasopharyngeal carcinoma screening and specific magnetic resonance diagnosis.

The invention relates to primers and probes for detection of various respiratory viruses and provides a primer-probe assembly for detecting cytomegalovirus, EB (epstein-barr) virus and adenovirus. Sequences of a probe and a primer pair for detecting the cytomegalovirus, the EB virus and the adenovirus are as shown in SEQ ID NO:1-9. The invention further provides a kit for simultaneous detection of the cytomegalovirus, the EB virus and the adenovirus. By combination of multiplex PCR (polymerase chain reaction) and Taqman fluorescent probe technique, simultaneous detection of various pathogens possibly causing acute respiratory infection can be realized in one-time detection, and quickness in diagnosis and treatment guide is realized. In addition, shortening of operation time and reduction of raw material consumption are realized, and high sensitivity and specificity, effectiveness in solving of PCR pollution, high automation degree and the like are achieved.

The invention relates to preparation and application of multi-epitope recombinant protein of epstein-barr (EB) virus latent membrane protein 2. The invention discloses the multi-epitope recombinant protein rich in a plurality of CTL epitopes, Th epitopes and B cell epitopes obtained by screening based on the full-length EB virus latent membrane protein 2. The invention also discloses the coding nucleic acid of the protein, and comprises a nucleic acid recombinant vector and a host cell. The invention also discloses the application of the protein in the aspects of preventing, treating and diagnosing EB virus infection and related disease thereof. The protein of the invention has very strong immunogenicity and antigenicity and good application prospect.

The present invention relates to peptides immunochemically reactive with antibodies to the Epstein-Barr virus (EBV), nucleic acid sequences encoding these peptides, monoclonal antibodies against these peptides, cell lines capable of producing monoclonal antibodies and anti-idiotype antibodies. The invention also relates to recombinant vector molecules comprising a nucleic acid sequence according to the invention and host cells transformed or transfected with these vector molecules. The invention is further concerned with immunological reagents and methods for the detection of EBV or anti-EBV antibodies and a method for the amplification and detection of Epstein Barr viral nucleic acid.

The invention discloses a method for detecting specificity of Epstein-Barr viruses (EBV) through an Epstein-Barr virus p18-p23 fused capsid antigen. The method is characterized in that an overlap extension polymerase chain reaction (PCR) technology is adopted; a coding gene p23 and a coding gene p18 are fused in vitro by a coding sequence of an intermediate head (Gly4Ser)3; a fused protein is expressed and the expressed fused protein is purified and is subjected to specificity identification through an immunoblotting technology; the purified fused protein is coated on an enzyme-linked immuno sorbent assay (ELISA) reaction plate and component content and reaction conditions are optimized; commercial horseradish peroxidase-labelled goat anti-human IgM and IgG and a series of other reagents are prepared; and EBV-viral cuspid antigen (VCA) specific IgM and IgG indirect ELISA diagnostic kit is obtained by assembling.

The invention provides a method for identifying lymphocyte subpopulations infected by an EB (epstein-barr) virus and a proportion of injected cells in the lymphocyte subpopulations and application ofthe method, and relates to the technical field of medical test. According to the method, a probe is mixed with a mononuclear cell extracted from preprocessed peripheral blood, and after hybridization,a flow cytometry measurement method is adopted to acquire and analyze to identify the lymphocyte subpopulations infected by the EB virus and the proportion of the injected cells in the lymphocyte subpopulations. The method has the advantages that the type of cells infected by the EBV (epstein-barr virus) can be found out accurately, the proportion of the infected cells in the lymphocyte subpopulations can be found out, according to the type of the cells infected by the EBV and the proportion of the infected cells, a targeted therapeutic schedule can be beneficially made to effectively and accurately treat diseases caused by EBV injection, and accordingly the method plays important roles in implement of accurate therapy and prognosis improvement of a patient.

The invention belongs to the field of biomedicine, in particular to a kit for detecting integrated viruses of a genome in hybrid capture. The kit comprises the following main components: (1) a solid phase medium fixed with a capture mixture of human genome DNA (Deoxyribonucleic Acid) single-chain molecules, (2) positive and negative quality control materials for identifying the hybrid capture efficiency and specificity, and (3) a primer pair and a molecular probe for carrying out real-time PCR (Polymerase Chain Reaction) identification to the captured mixture of the target DNA molecules, obtained by capture. By utilizing all or partial components in the invention, a complete integrated genome virus detection kit or an integrated genome virus detection kit with the type specificity can be assembled. The obtained virus detection kit can be used for detecting and identifying the integrated state of the genome in a certain common integrated and oncogenic viruses, such as human hepatitis B viruses, human papilloma viruses, Epstein-Barr viruses and human herpes simplex viruses, in tissue or cytology specimens.

The invention relates to a medical immunodetection method and in particular relates to a method for detecting an EB (Epstein-Barr) virus by an immunological method by using a quantum dot labelled immunochromatographic test strip. The quantum dot labelled immunochromatographic test strip is characterized in that a glass cellulose membrane A, a glass cellulose membrane B of a quantum dot labelled EB virus IgA (immunoglobulin A) monoclonal antibody, a nitrocellulose membrane and absorbent paper are stuck to a plastic board from bottom to top in sequence, wherein one end of the nitrocellulose membrane is provided with an EB virus polyclonal antibody and a rabbit anti-mouse second antibody, thereby forming a detection zone T and a quality control zone C; the quantum dot labelled EB virus IgA monoclonal antibody is arranged at the other end of the glass cellulose membrane B, corresponds to the detection zone T and the quality control zone C and is arranged at one end of a sampling point. The detection sensitivity of the method is about 1000 times higher than that of the detection method frequently used at present.

The invention relates to a medical application of EB (Epstein-Barr) virus miR-BART3 antisense oligonucleotides, in particular relating to an application of EB virus miR-BART3 antisense oligonucleotides in preparing a medicament for treating nasopharyngeal darcinoma, wherein the sequence of the EB virus miR-BART3 antisense oligonucleotides is ACACCUGGUGACUAGUGGUGCG (SEQ ID NO:1). The EB virus miR-BART3 antisense oligonucleotides can be effectively combined with mature miRNA of the EB virus to block the expression of the miRNA and corresponding regulation action thereof, thus restraining the invasion and metastasis of nasopharyngeal darcinoma cells; and the miRNA has no immunogenifcity, thus being favorable for being further applied in preventing the recurrence and metastasis of the nasopharyngeal darcinoma. The medicament can be used for protecting the antisense oligonucleotides from being degraded by nuclease and prolonging the action time, has higher transfection effciciency than that of commodity liposome, and is favorable for further practical clinical development and application.

The invention provides compounds with EB (Epstein-Barr) virus and Kaposi's sarcoma-associated herpesvirus (KSHV) resisting activities and sources thereof, and a separation purification method and application of the compounds. The compounds 1-18 are separated and purified from Hypericum japonicum, wherein the compounds 1-10 are separated and purified from Hypericum japonicum collected in Dabieshan in Qichun County of Hubei Province in October, and the compounds 11-18 are separated and purified from Hypericum japonicum collected in Lushan in Lushan City of Jiangxi province. The research of the antivirus activities of the 18 compounds on the two tumorigenic herpesviruses detects that the compounds 1, 3, 4, 7 and 8 have inhibiting activities for DNA replication of EB virus; and the compounds 3, 6 and 13-17 have inhibiting activities for replication of KSHV in the pyrolysis stage.