Application of herba saussureae involucratae sikPrx gene in cultivating stress-resistant plant
A technology of transgenic plants and genes, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Extraction of Monoclonal Plasmids from the Tianshan Saussurea cDNA Library
[0048] Take the glycerol tube in which the monoclonal preservation of the Saussurea tianshanensis cDNA library was preserved, and place it in 10 ml of LB liquid medium (Cm 50 μg / ml), and culture it overnight at 37°C and 220 rpm with shaking. Dip the bacterial solution and streak culture on LB solid medium (Cm 50 μg / ml) plate, and cultivate in dark at 37°C for 12-16hr. Pick a single clone in 20ml LB liquid medium (Cm 50μg / ml), shake and culture at 220rpm at 37°C for 14hr, and extract the plasmid. The specific method is as follows:
[0049] 1) Divide the bacterial solution into 1.5ml Ep tubes, centrifuge at 12000rpm for 3min, and discard the supernatant;
[0050] 2) Add 400ml of STE solution, resuspend, centrifuge at 12000rpm for 3min, and discard the supernatant;
[0051] 3) Resuspend the precipitate with 150 μL of alkaline lysis solution I, and mix well;
[0052] 4) Add freshly pr...
Embodiment 2
[0057] Embodiment 2: Cloning the sikPrx gene from Saussurea tianshanensis
[0058] Using the monoclonal plasmid of the Snow Lotus cDNA library as a template, PP1 whose sequence is 2 and PP2 whose sequence is 3 were used as primers to amplify, and deionized water was used as a template to amplify as a negative control.
[0059] PP 1 For: 2
[0060] 5'TCTAGAAGATTCAACGATGGCT 3'
[0061] PP 2 For: 3
[0062] 5'GAGCTCTTAGTTATACAGCTGCAA 3'
[0063] The PCR reaction system (20μl) is:
[0064] 10×PCR Buffer 2.0μl
[0065] dNTPs (2.5mM each) 0.5μl
[0066] MgCl 2 (25mM) 1.2μl
[0067] Upstream primer (25μM) 0.5μl
[0068] Downstream primer (25μM) 0.5μl
[0069] Template DNA (ddH 2 O) 0.5 μl
[0070] Taq DNA Polymerase (2.5U / μl) 0.3μl
[0071] wxya 2 O 14.5 μl
[0072] Total 20.0μl
[0073] The PCR reaction program was: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, and 30 cycles; extension at 7...
Embodiment 3
[0075] Embodiment 3: Construction sikPrx gene plant expression vector
[0076] Construction of plant expression vector: pBI121-sikPrx. The plant expression vector pBI121 was double digested with XbaI / SacII respectively to obtain the vector fragment. Recover target gene fragments and vector fragments. The target gene fragment was ligated with the vector fragment in vitro, and the identified correct recombinant plasmids were respectively named pBI121-sikPrx. In this embodiment, we choose tobacco as the transgenic plant material, and other plants can also be used as the transgenic material. Such as Figure 4 , 12 .
[0077] In this embodiment, the sikPrx gene and pBI121 constitute a plant expression vector for plant transformation. According to this embodiment of the present invention, in addition to pBI121, other plant expression vectors can also be selected for construction of the selected plant expression vector.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More