Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA)

A technology for recombining Escherichia coli and aminolevulinic acid, which is applied in the fields of genetic engineering and microbial fermentation, can solve problems such as high cost and complex biotransformation process, and achieve important industrial application value

Active Publication Date: 2011-10-05
SHANDONG UNIV
View PDF0 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, since succinic acid is mainly prepared by chemical synthesis, the cost of biotransforming ALA with succinic acid and glycine as substrates is relatively high, and at the same time, the high concentration of glycine (>1.7g / L) can inhibit the growth of bacteria, so The biotransformation process is relatively complex
At the same time, the medium used in the biotransformation is an expensive LB medium, so this has also become a bottleneck for the industrialization of ALA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA)
  • Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA)
  • Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1, the construction of gltX gene expression vector

[0051] According to the Escherichia coli genome sequence published by NCBI, use the primer gltX-F: 5'-TCC CTGCAG AAAGGAGGATATACATATGAAAATCAAAACTCGCTTCGCGC-3′ and gltX-R:5′-GGC GTC GAC TTACTGCTGATTTTCGCGTTCAGCAATAAAATCC-3' The gltX gene was cloned from the E. coli genome or directly using colony PCR. The cloned gltX fragment was digested with endonucleases PstI and SalI respectively, and the plasmid vector pUC19 was also digested with endonucleases PstI and SalI respectively. The digested gltX fragment and the pUC19 plasmid vector were recovered using an agarose gel kit, and then ligated using T4 ligase. The connection system is 10 μL:

[0052] gltX fragment: 6 μL

[0053] pUC19 vector: 2 μL

[0054] 10×Buffer: 1μL

[0055] T4 ligase: 1 μL

[0056] After ligation at 16°C for 12 h, 10 μL of the ligation solution was transformed into Escherichia coli DH5α competent cells. The transformation process i...

Embodiment 2

[0057] Embodiment 2, the construction of hemL gene expression vector

[0058] According to the Escherichia coli genome sequence published by NCBI, use primer hemL-F: 5′-ACA GGATCC AAAGGAGGATATACATATGAGTAAGTCTGAAAATCTTTTACAGCG-3′ and hemL-R:5′-AAT GAGCTC TCACAACTTCGCAAACACCCGACGTGCAGCA-3' cloned the hemL gene from the E. coli genome or directly by colony PCR. The cloned hemL fragment was digested with endonucleases BamI and SacI respectively, and the plasmid vector pUC19 was also digested with endonucleases BamI and SacI respectively. The digested hemL fragment and the pUC19 plasmid vector were recovered using an agarose gel kit, and then ligated using T4 ligase. The connection system is 10 μL:

[0059] hemL fragment: 6 μL

[0060] pUC19 vector: 2 μL

[0061] 10×Buffer: 1μL

[0062] T4 ligase: 1 μL

[0063] After ligation at 16°C for 12 h, 10 μL of the ligation solution was transformed into Escherichia coli DH5α competent cells. The transformation process is as follow...

Embodiment 3

[0064] Embodiment 3, the mutation of hemA gene and the construction of expression vector

[0065] According to the Salmonella genome sequence published by NCBI, using primer hemA M -F: 5′-CCC GTC GAC AAAGGAGGATATACATATGACCAAGAAGCTTTTAGCACTCGGTATCAAC-3′ and hemA M -R: 5′-AAA TCTAGA CTACTCCAGCCCCGAGGCTGTCGCGCAGA-3′ clone hemA from E. coli genome or directly by colony PCR M Gene. The cloned hemL fragment was digested with endonucleases SalI and XbaI respectively, and the plasmid vector pUC19 was also digested with endonucleases SalI and XbaI respectively. digested hemA M The fragment and pUC19 plasmid vector were recovered using an agarose gel kit, and then ligated using T4 ligase. The connection system is 10 μL:

[0066] hemA M Fragments: 6 μL

[0067] pUC19 vector: 2 μL

[0068]10×Buffer: 1μL

[0069] T4 ligase: 1 μL

[0070] After ligation at 16°C for 12 h, 10 μL of the ligation solution was transformed into Escherichia coli DH5α competent cells. The transformat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant escherichia coli which is called recombinant escherichia coli DALA. The recombinant escherichia coli DALA is prepared through the following steps: constructing a co-expression vector p-hemA<M>-hemL containing hemA<M> gene and hemL gene; constructing an expression vector p-rhtA containing rhtA gene; and converting constructed recombinant plasmids of p-hemA<M>-hemL and p-rhtA to the escherichia coli to obtain the recombinant escherichia coli DALA which can overexpress the hemA<M> gene, the hemL gene and the rhtA gene. The invention also discloses an application of the recombinant escherichia coli in production of the ALA. A fermentation result shows that the output of the ALA produced by the recombinant escherichia coli achieves 4.13 g / L, the conversionrate of the ALA to glucose is 0.168 g / g and the escherichia coli has good industrial development and application prospects.

Description

technical field [0001] The invention relates to the fields of genetic engineering and microbial fermentation, in particular to a strain of recombinant Escherichia coli and its construction method and the application of the recombinant strain in the production of 5-aminolevulinic acid (ALA). Background technique [0002] 5-Aminolevulinic acid (ALA), which has the molecular formula C 5 o 3 NH 9 , with a molecular weight of 131.13 and a melting point of 118°C, ALA has important applications in agriculture. Studies have shown that it is a pollution-free natural substance and is biodegradable. 5-Aminolevulinic acid is a new type of pesticide. Because it is easy to degrade in the environment, has no residue, and is non-toxic to mammals, it has attracted attention as a pollution-free green pesticide. ALA is also widely used in the field of agriculture, mainly used in green herbicides, plant growth regulators, insecticides and other aspects. In addition to the application in ag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12R1/19C12P13/00
CPCC12P13/005C12N9/0008C07K14/245C12N15/70C12N9/90
Inventor祁庆生康振王阳王倩
OwnerSHANDONG UNIV