Slow-virus vector system and preparation method thereof

A lentiviral vector and virus technology, applied in the field of lentiviral vector system and its preparation, can solve the problems of long time consumption and high production cost, and achieve the effects of low cost, low cost and high virus titer

Inactive Publication Date: 2011-11-02
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing packaging and purification methods in the preparation of lentivirus have the disadvantages of high production cost and long time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Slow-virus vector system and preparation method thereof
  • Slow-virus vector system and preparation method thereof
  • Slow-virus vector system and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Preparation of dual fluorescent lentiviral expression vector

[0033] Primer synthesis and sequence determination were completed by Shanghai Sangon Bioengineering Co., Ltd.

[0034] 1) Design primers with the red fluorescent protein gene in the vector pDsRed1-N1, and introduce at both ends of the gene not I and Bam HI restriction site, the primer sequence is as follows:

[0035]DsRed-F: GCGGCCGCCGCCACCATGGTGCGCTC

[0036] DsRed-R: GGATCCCTACAGGAACAGGTGGTGG

[0037] 2) Using the plasmid pDsRed1-N1 as a template, the red fluorescent protein gene (DsRed) was amplified by PCR, and the amplified product was ligated into the T vector, after enzyme digestion and sequencing identification, not I and Bam HI double enzyme digestion, gel recovery kit (Tiangen Biochemical) to recover the DsRed gene fragment.

[0038] 3) Use the lentiviral vector CSⅡ-EF-MCS-IRES2-Venus not I and Bam After HI double digestion, recover the digested product, and use T4 DNA liga...

Embodiment 2

[0061] Replace the shuttle plasmid with CSⅡ-EF-MCS-IRES2-Venus

[0062] The remaining experimental steps are as in Example 1. The number of plasmid transfected cell dishes is 50 dishes, and the corresponding reagents are increased in proportion. When the titer is measured, the number of cells before inoculating the virus is 6.7×10 5 .

[0063] Table 2 Proportion of positive cells at different dilution digits

[0064] Dilution factor control 10 3 10 4 10 5 10 6 10 7 Positive cell ratio 0% 89% 47.09% 8.58% 1.41% 0.19%

[0065] After concentration, the virus titer is = {(percentage of positive cells measured × total number of cells when infected cells) / inoculated virus volume} × dilution factor = {(8.58% × 6.7 × 105 / 1 ml)} × 105 = 5.75 × 10 9 .

[0066]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a slow-virus vector system and a preparation method thereof, belonging to the field of biotechnology. The slow-virus vector system comprises a shuttle plasmid CSII-EF-MCS-IRES2-Venus, a packaging plasmid pCAG-HIVgp and an envelop protein plasmid pVSV-G-RSV-Rev; a host cell is transfected by the shuttle plasmid CSII-EF-MCS-IRES2-Venus, the packaging plasmid pCAG-HIVgp and the envelop protein plasmid pVSV-G-RSV-Rev in the vector system, namely the plasmids are packaged in the host cell to obtain the slow-virus vector system. Compared with the prior art, the slow-virus vector system and the preparation method thereof provided by the invention have the advantages as follows: (1) the cost is low: by taking the transfection of cells in per 10 centimeters of 10 dishes asexample, the price of the recommended liposome 2000 with the volume of 600 microliters (60 microliters*10) is about 1500 yuan; however, the cost consumed by utilizing the method can be reduced to 0.62 yuan so that the cost can be greatly reduced; (2) the transfecting efficiency is high and the transfecting rate can be more than 80%; and (3) and the valence of the virus is high and can be 5.79*10<9>.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a lentiviral vector system and a preparation method thereof. Background technique [0002] Lentivirus belongs to the Lentivirus genus of the Retroviridae family and is an RNA virus. Lentivirus vector (LV) is based on HIV-1 (human immunodeficiency disease) virus and developed by deleting part of the genome gene as a vector for gene therapy and gene transfer (An DS et al., J Virol, 2001. 75(8): 3547-3555.). Compared with ordinary retroviral vectors, lentiviral vectors have many advantages, such as it has a wide range of infection host domains, and can infect both dividing and non-dividing cells (Naldini L et al., Science, 1996, 272(5259): 263 -267), even can infect cells in G0 phase (Korin YD et al., J Virol, 1998. 72(4): 3161-3168.); It shows high transfection efficiency for various types of cells; it can The target gene is efficiently integrated into the host genome an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867
Inventor潘建治于福先朱志伟陈晓宇
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES