Method for rapidly classifying and identifying fish larvae

A technology for rapid classification and identification methods, applied in biochemical equipment and methods, and microbial measurement/inspection. The effect of short cycle and overcoming limitations

Active Publication Date: 2013-06-26
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the extremely small fish individuals in the early development stage, the various external forms have not yet differentiated, and it is difficult to distinguish the differences between individuals by visual inspection. Therefore, the classification and identification of samples has become a technical bottleneck that restricts the development of ecological research on larvae and juveniles.
In previous studies, in order to improve the accuracy of identification, the method of cultivating the seedlings for a short period of time and then identifying them after morphological differentiation was usually adopted. Conventional methods have significant limitations at longer distances

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0015] The present invention is a kind of rapid classification and identification method for juvenile fish, which adopts the following steps:

[0016] 1. Obtain fish samples that can be accurately classified and identified through fixed-point fishing and market purchases in the surveyed waters. Take fresh back muscles, fix them with 70% ethanol, digest with proteinase K, and extract DNA with phenol-imitation conventional methods. Save for later use;

[0017] 2. Select the relatively conserved mitochondrial 16S rRNA fragment as the characteristic fragment, and select the universal amplification primer as; Forward primer: TCGCCTGTTTACCAAAAAACATCGCCT;

[0018] Reverse primer:AACCCTTAATAGCGGCTGCACCATT;

[0019] 3. The reaction system of PCR amplification is: pre-denaturation at 94°C for 2 minutes; each cycle of 94°C for 1 minute, 57°C for 30 seconds, and 72°C for 1 minute, a total of 35 cycles, and finally 72°C for 8 minutes;

[0020] 4. After the PCR product was detected by 1% ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for rapidly classifying and identifying fish larvae and is characterized in that the types of fish larvae are rapidly determined by the following steps of: collecting fish samples capable of being accurately classified and identified in an investigated water area, performing PCR (polymerase chain reaction) and sequencing on mitochondrial 16SrRNA fragments of different types of fishes respectively, establishing a DNA fingerprint library of the investigated water area, then numbering the fish larva samples which can not be morphologically differentiated by visual observation, extracting DNA of the numbered samples respectively, performing PCR amplification and sequencing on characteristic fragments by the same way, and comparing with the established DNA fingerprint library. The method provided by the invention can rapidly classify and identify the fish larvae which are in the early development stages and hard to be morphologically differentiated, overcomes the problems in the prior art that the visual observation has a high error rate and a large amount of samples required for classification need to be cultured, and is advantageous in rapidness and accuracy.

Description

technical field [0001] The invention relates to a method for rapid classification and identification of larvae and juveniles. Background technique [0002] When fish are in the early developmental stage, both morphology and physiology will undergo significant changes, and thus have obvious stage characteristics. At present, the generally accepted view is that the early developmental stage includes the embryonic stage, larvae stage and juvenile stage. The investigation of early fish resources That is, the resource survey work is carried out on the individual fish at this stage. The investigation of early fish resources can not only estimate the number of fish breeding populations, but also estimate the number of supplementary populations, and then scientifically predict the changes in fish populations, providing a scientific basis for the protection and rational development and utilization of fishery resources. Relevant work in China has progressed slowly. The existing resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 刘凯施炜纲张敏莹段金荣周彦锋徐东坡
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap