Method for rapidly classifying and identifying fish larvae
A technology for rapid classification and identification methods, applied in biochemical equipment and methods, and microbial measurement/inspection. The effect of short cycle and overcoming limitations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0015] The present invention is a kind of rapid classification and identification method for juvenile fish, which adopts the following steps:
[0016] 1. Obtain fish samples that can be accurately classified and identified through fixed-point fishing and market purchases in the surveyed waters. Take fresh back muscles, fix them with 70% ethanol, digest with proteinase K, and extract DNA with phenol-imitation conventional methods. Save for later use;
[0017] 2. Select the relatively conserved mitochondrial 16S rRNA fragment as the characteristic fragment, and select the universal amplification primer as; Forward primer: TCGCCTGTTTACCAAAAAACATCGCCT;
[0018] Reverse primer:AACCCTTAATAGCGGCTGCACCATT;
[0019] 3. The reaction system of PCR amplification is: pre-denaturation at 94°C for 2 minutes; each cycle of 94°C for 1 minute, 57°C for 30 seconds, and 72°C for 1 minute, a total of 35 cycles, and finally 72°C for 8 minutes;
[0020] 4. After the PCR product was detected by 1% ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com