Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Helicobacter pylori antigenic peptide and its application

A technology of Helicobacter pylori and antigenic peptide, applied in the field of immunology, can solve problems such as affecting growth rate or egg production

Active Publication Date: 2011-11-30
SHENZHEN GENEBIOHEALTH
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, especially for livestock and poultry, this creates a stress response, etc., which affects their growth rate or egg production, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Helicobacter pylori antigenic peptide and its application
  • Helicobacter pylori antigenic peptide and its application
  • Helicobacter pylori antigenic peptide and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0086] Example 1. Analysis and determination of the amino acid sequence and nucleotide sequence of Helicobacter pylori urease, catalase and the immune protective epitope of the outer membrane protein with adhesion function

[0087] 1. Preparation of monoclonal antibodies against Helicobacter pylori urease, catalase and outer membrane proteins hp0231 and hp0410 with adhesion function.

[0088] (1) Virus replication and purification

[0089] According to the genome sequence of Helicobacter pylori HP26695 strain provided by GenBank, primers were designed respectively:

[0090] ureB gene: Pf: AGATCTCTAATACTTTTTCTAATCG,

[0091] Pr:AAATCGTAAAAGATCAATCGTCGAC;

[0092] katA gene: Pf: AGATCTCTAATACCAATTATTTCTA,

[0093] Pr: TTTTTCTTTTTCATTAATCGTCGAC;

[0094] hp0231 gene: Pf: AGATCTCTAATACTATAATTCTCGC,

[0095] Pr: GTAATATTCCGTACTAATCGTCGAC;

[0096] hp0410 gene: Pf: AGATCTCTAATACTTTTTTTCCATCA,

[0097] Pr: TTTTTTGCTTTCATCAATCGTCGAC),...

Embodiment 2

[0127] Example 2. Construction and preparation of eukaryotic expression plasmid vector pNSPs-IRES

[0128] 1. PCR amplification of NSPs gene

[0129] First, according to the eukaryotic expression plasmid vector pIRES-neo (Invitrogen), two target cloning sites on both sides of the neo gene were found, one was located at the start point after the fi ori sequence before the neo gene; the other was located at the BamHI after the neo gene Start point before restriction site. Then use the NSPs (NSP1, NSP2, NSP3 and NSP4) genes in the pNSPs plasmid (pSFV1 derived from GIBCO company) as a template to design PCR primers, and add 25 bp from the pIRES-neo plasmid and the above two genes to the 5' end of the primers. sequence homologous to each cloning site, thus obtaining PCR primers PA (SEQ ID NO: 11) and PB (SEQ ID NO: 12).

[0130] The PCR reaction conditions were: 94°C pre-denaturation for 5 minutes, 94°C for 30s, 60°C for 30s, 72°C for 2min, 30 cycles, and 72°C extension for 10 mi...

Embodiment 3

[0138] Example 3. Construction of eukaryotic expression recombinant plasmid pNSPs-tPA-nEpitope-IRES-MyD88

[0139] The recombinant eukaryotic plasmid containing the tandem nucleotide sequence (nEpitope) of Helicobacter pylori urease, catalase and two outer membrane protein immunoprotective antigenic epitopes with adhesion function was constructed by overlapping PCR method, and a specific The 12 primers (P1-P12) were obtained by PCR to connect their nucleotide sequences, and they were inserted into the above-mentioned eukaryotic expression plasmid pNSPs-IRES. Specifically, the immunoprotective epitope sequences (B cell epitopes, SEQ ID NO: 1-7) of Helicobacter pylori urease, catalase and two outer membrane proteins with adhesion function, urea The T-cell epitope of the enzyme (SEQ ID NO:8-9) and the nucleotide sequence of an exogenous universal T-cell epitope (SEQ ID NO:10) are combined into a tandem sequence (nEpitope), and before the tandem sequence The signal peptide gene (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to antigen peptide containing Helicobacter pylori protective epitope, polypeptide containing the antigen peptide, nucleic acid for encoding the polypeptide, antibody for the antigen peptide, and related vaccine, composition and kit for treating, preventing and diagnosing the Helicobacter pylori.

Description

technical field [0001] The present invention relates to the field of immunology, in particular to antigenic peptides containing protective antigenic epitopes of Helicobacter pylori, polypeptides containing the antigenic peptides, encoding nucleic acids thereof, antibodies thereof and methods for treating, preventing and diagnosing Helicobacter pylori Related vaccines, compositions and kits. Background technique [0002] Helicobacter pylori (Helicobacter plori, HP) is the first type of carcinogen identified by the World Health Organization. The infection rate of HP is 80% in ulcer patients, 60% in healthy people, and 70% in people over 60 years old. At present, in some developed countries, although the infection rate of HP has decreased, there are still a large number of infected persons; while in developing countries, the infection of HP is more serious. At present, antibiotics are often used to treat HP infection clinically. Although the infection can be cured to a certain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/06C07K19/00C07K16/12C12N15/31C12N15/63A61K48/00A61K39/116A61K39/02A61K39/40A61P31/04G01N33/569
Inventor 于浩洋
Owner SHENZHEN GENEBIOHEALTH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com