Preparation method of a recombinant nuclear polyhedrosis virus capable of infecting tea geometrids
A karyotype polyhedron and recombinant virus technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, viruses/phages, etc., can solve the problem of high cost of EcobNPV, difficulty in large-scale rearing, and immature artificial rearing technology of tea inchworm and other problems, to achieve the effect of easy production control and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: The construction of recombinant nuclear polyhedrosis virus capable of infecting tea geometrids includes the following steps,
[0035] 1. According to the complete genome sequence of EcobNPV registered in GenBank (accession number is DQ837165), primers were designed at both ends of the viral helicase gene:
[0036] SEQ ID No. 1: Eo-Helicase 1: GA ACTAGT ATGATTGGTGTAATCGT (underlined Speech I site),
[0037] SEQ ID No. 1: Eo-Helicase 2: CA CTGCAG ACTTTGCACGTAGTTTGTGTATATG (underlined Pst I site),
[0038] 2. Using EcobNPV DNA as a template, carry out PCR amplification with Eo-Helicase1 and Eo-Helicase1 primers. For the agarose gel electrophoresis pattern of the PCR product, see figure 1. Cloning the amplified EcobNPV envelope protein odv-e25, odv-e28 and helicase gene fragments (about 5.0 kb) into the pMD19-T (TAKARA company product) vector to obtain pMD19-helicase;
[0039] For the identification results of pMD19-helicase, see figure 2 . Fo...
Embodiment 2
[0050] Embodiment two: the application of the recombinant virus BmEoNPV that embodiment one obtains
[0051] The recombinant virus polyhedron that embodiment one obtains is prepared 10 8 The virus liquid of polyhedron / ml is sprayed on tea trees, and the 3-4 age tea geometrids caught in the field are stocked in tea trees sprayed with recombinant virus polyhedrons, and they feed naturally. After one week, the natural infection mortality of tea geometrids up to 63%.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
