Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for efficiently preparing porcine circovirus type 2 empty capsid particles

A technology of porcine circovirus and empty capsid particles, which can be used in microorganism-based methods, botanical equipment and methods, biochemical equipment and methods, etc., and can solve problems such as low expression levels

Active Publication Date: 2011-12-28
CHINA INST OF VETERINARY DRUG CONTROL +1
View PDF2 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the codon preference of this signal peptide, the expression level in bacteria is very low (Nawagitgulet al., Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. ClinDiagn Lab Immunol, 2002.9(1): p.33-40)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently preparing porcine circovirus type 2 empty capsid particles
  • Method for efficiently preparing porcine circovirus type 2 empty capsid particles
  • Method for efficiently preparing porcine circovirus type 2 empty capsid particles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0211] Expression of improved porcine circovirus antigen gene cap7 in silkworm bioreactor and assembly of empty capsid particles

[0212] Through the analysis of the experimental results of Example 1, it is found that if the highly expressed nuclear localization signal of cap5 is combined with the characteristic amino acid sequence of 47A and 59A highly expressed in cap2, it is possible to further improve the cap gene in the silkworm bioreactor expression efficiency.

[0213]We designed the following primers respectively: cap2-5F: 5'-GAAAAATGGCATCTTCAACGCCCG CCTCTC-3 (SEQ ID No.35) and cap2-5R: 5'-GAGAGGCGGGCGTTGAAGATGCCAT TTTTC-3' (SEQ ID No.36), using cap5F and cap2-5R respectively As primers, cap5 gene DNA was used as a template for PCR amplification; cap2-5F and cap2R were used for cap2 gene DNA as a template for PCR amplification. Finally, cap5F and cap2R were used as primers, and the corresponding PCR amplification products were purified and used as templates for fusion...

Embodiment 3

[0216] Embodiment three, the animal experiment of porcine circovirus type 2 empty capsid particles expressed by silkworm

[0217] 1. Vaccine Preparation

[0218] Use the empty capsid particles of PCV2 virus purified in Example 2, check the pure empty capsid virions with an electron microscope, and after protein quantification, use oil or Aqueous adjuvant, the vaccine is prepared by mixing antigen and adjuvant in a ratio of 1:1, and is used for intramuscular injection to immunize one to two-week-old piglets negative for PCV2 antigen antibody.

[0219] 2. Immunization of Animals

[0220] Screen 70 PCV2 antigen antibody-negative healthy piglets aged 1-2 weeks, and randomly divide them into 7 groups with 10 piglets in each group. Groups 1-6 are divided into 0μg, 15μg, 30μg, 60μg, 90μg, and 120μg / head respectively according to the antigenic protein content. Dose, intramuscular injection of piglets, in which the commercialized PCV2 vaccine was used as a positive control in Group 7...

Embodiment 1

[0617] Expected amplification result in Example 1: the first pair of primers PCVF-1F used for 1465bp

[0618] 16

[0619] GCTCCCGTATTTTCTTGCGCTCGTC 25

[0620] 17

[0621] 25

[0622] DNA

[0623] Artificial sequence

[0624]

[0625] Expected amplification result in Example 1: the first pair of primers PCVF-1R used for 1465bp

[0626] 17

[0627] CAAACGTTAC AGGGTGCTGC TCTGC 25

[0628] 18

[0629] 25

[0630] DNA

[0631] Artificial sequence

[0632]

[0633] Expected amplification result in Example 1: the first pair of primers PCVF-2F used for 1400bp

[0634] 18

[0635] CGTTACAGGG TGCTGCTCTG CAACG 25

[0636] 19

[0637] 27

[0638] DNA

[0639] Artificial sequence

[0640]

[0641] Expected amplification result in Example 1: the first pair of primers PCVF-2R used for 1400bp

[0642] 19

[0643] GAGCTTCTAC AGCTGGGACA GCAGTTG

[0644] 20

[0645] 35

[0646] DNA

[0647] Artificial sequence

[0648]

[0649] Primer PCV2-cap1F used in Ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for efficiently preparing porcine circovirus 2 type empty capsid, which comprises the following steps: cloning different viral strain lines of antigen genes cap required by forming circovirus empty capsid and artificially reconstructed cap mutant into a domestic silkworm baculovirus carrying vector to obtain a homologous recombinant vector, recombining or transpositioning the homologous recombinant vector and parent virus DNA (deoxyribonucleic acid) in an insect cell or bacterium to obtain recombinant baculovirus, and infecting the insect with the recombinant baculovirus containing the antigen gene; and culturing the infected insect host to express the corresponding circovirus 2 type empty capsid, determining the information required by efficiently assembling the virus empty capsid by comparison and experimentation, and obtaining a recombinant viral strain line capable of efficiently expressing and assembling virus empty capsid, thereby carrying out mass production on the circovirus 2 type empty capsid. The porcine circovirus 2 type empty capsid produced by the method can be used for preparing vaccines for preventing and treating porcine circovirus disease after being subjected to primary purification.

Description

technical field [0001] The present invention relates to a method for preparing circovirus empty capsid particles using a eukaryotic expression system, in particular to the use of recombinant baculovirus to efficiently express antigen genes or artificially modified antigen genes in insects and assemble virus empty capsid particles The method is used for preparing a genetic engineering vaccine for preventing porcine circovirus disease, and belongs to the field of genetic engineering and veterinary biological products. Background technique [0002] 1. Overview of porcine circovirus disease [0003] Porcine circovirus type 2 (PCV2) is the main pathogen of related diseases such as Postweaning multisystemic wasting syndrome (PMWS) in weaned piglets. It is a non-enveloped tetrahedron, single-stranded circular DNA virus with a genome length of 1 767bp or 1 768bp, containing 11 reading frames, but only two of them have clear coding products, rep and cap. Porcine circovirus is divi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/866C12N7/04A61K39/12A61P31/20C12R1/93
Inventor 郎洪武张志芳李轶女陈晓春易咏竹高金源丁农吴华伟邓永韦永龙边大勇杨标
Owner CHINA INST OF VETERINARY DRUG CONTROL