Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of GmNDR1 protein to promoting biosynthesis of salicylic acid and enhancing vegetal disease resistance

A technology of salicylic acid and protein, applied in the field of protein to enhance plant disease resistance, can solve the problems of high equipment and personnel requirements, long cycle and low success rate

Inactive Publication Date: 2012-05-30
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, except for Arabidopsis thaliana and tobacco, there is still no report on the genetic engineering of this gene in other plants (Dou Daolong, Wang Bingshan, Zhu Shengwei, etc., NDR1 transgenic tobacco has enhanced resistance to red spot disease and late blight, Chinese Agricultural Sciences, 2003, 36(10): 1120-1124)
Since the genetic transformation of soybean still has some problems such as low success rate, long cycle and high requirements for equipment and personnel, whether overexpression of soybean NDR1 gene will induce the synthesis of salicylic acid and the expression of plant disease resistance genes, which may improve plant Disease resistance, still no clear answer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of GmNDR1 protein to promoting biosynthesis of salicylic acid and enhancing vegetal disease resistance
  • Application of GmNDR1 protein to promoting biosynthesis of salicylic acid and enhancing vegetal disease resistance
  • Application of GmNDR1 protein to promoting biosynthesis of salicylic acid and enhancing vegetal disease resistance

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0068] The present invention will be described in further detail below in combination with specific embodiments.

[0069] The methods used in the following examples are conventional methods unless otherwise specified. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" (Sambrook J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor). The primer synthesis and DNA sequence determination used were all carried out by Beijing Yingjun Biological Co., Ltd.

Embodiment 1

[0070] Example 1. Acquisition of the GmNDR1 gene related to salicylic acid synthesis

[0071] The Phytozome database and literature were searched to obtain the sequence of the GmNDR1 gene (accession number: Glyma12g34210), and the forward primer was designed: 5'>GCTCTAGAATGGCGGCGGAGCACGAC>3' and the reverse primer 5'>GCGAGCTCGAACCCACAAGCCACAAAAAGG>3'. Extract the RNA of soybean leaves, obtain cDNA by reverse transcription, amplify the gene with TaKaRa’s PrimeSTAR HS high-fidelity enzyme method, construct it into the 326-FLAG expression vector, and transform the ligated product into Escherichia coli by heat shock method For the DH5α strain, select positive colonies and add them to 2.5ml of LB liquid medium containing 50mg / L ampicillin, and culture them in a shaker at 37°C and 180rpm for 12-16 hours. A small amount of plasmid was extracted, and after enzyme digestion and identification were correct, it was sent to Yingjun Biotechnology Co., Ltd. for sequence determination. Us...

Embodiment 2

[0073] Embodiment 2, Arabidopsis salicylic acid synthetic key gene ICS1 gene promoter (Pro AtICS1 ) of the acquisition

[0074] Search the NCBI database and literature, obtain the sequence of AtICS1 (accession number: AT1G74710), analyze the promoter sequence according to the method of bioinformatics, and design forward primers according to the sequence analysis results: 5'>AACTGCAGTTATCCACGCTTTGTCACACA>3' and reverse Primer 5'>CGGGATCCCCATTGCAGAAATTCGTAAAGT>3'. The RNA of Arabidopsis leaves was extracted, cDNA was obtained by reverse transcription, the gene was amplified by TaKaRa’s PrimeSTAR HS high-fidelity enzyme method, and constructed into a 326-GFP expression vector, and the ligated product was transformed into Escherichia coli DH5α strain, select positive colonies and add them to 2.5ml LB liquid medium containing 100mg / L ampicillin, and cultivate them in a shaker at 37°C and 180rpm for 12-16 hours. A small amount of plasmid was extracted, and after enzyme digesti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for producing vegetables with enhanced disease resistance. In some respects, the invention provides GmNDR1 protein and a coding gene of the same. The vegetal disease resistance is enhanced by regulating and controlling synthesis of salicylic acid in the vegetables by the protein.

Description

technical field [0001] The invention relates to a protein for enhancing plant disease resistance, its coding nucleotide sequence and application. Some aspects of the present invention relate to introducing the GmNDR1 protein coding nucleotide sequence provided by the present invention into plant cells and making it expressed, thereby promoting the synthesis of salicylic acid in plants and enhancing the disease resistance of plants. Background technique [0002] Plants often suffer from various diseases during the cultivation and production process. Some diseases pose a great threat to plant growth, such as root rot and gray spot. For crops, these diseases seriously impair their yield and quality. For plant diseases, at present, the main measures are to control them with drugs. Recently, people have begun to use abiotic inducers to induce plant disease resistance, and have been widely used in many important crops such as tobacco, potato, tomato, cucumber, bean, and rice. A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N5/10C07K14/415A01H5/00
Inventor 金京波蔡斌周晓锋
Owner INST OF BOTANY CHINESE ACAD OF SCI