Reporter gene plasmid vector, construction method and application
A reporter gene, plasmid vector technology, applied in the field of molecular biology, can solve the problems of restricted regulation, technical difficulties of large fragments of DNA, etc., and achieve the effect of system stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Construction of pBeloBAC11-I plasmid
[0029] 1) From the pGL3-enhancer vector not I / Bam HI site enzyme cleavage includes synthetic poly (A), multiple cloning site, luciferase reporter gene ( luc +) fragments. The enzyme digestion system is as follows:
[0030]pGL3-enhancer vector 0.4μg (1 μl)
[0031] BSA 0.5 μl
[0032] NotI 0.5 μl
[0033] Bam HI 0.5 μl
[0034] 10×NEBBuffer 3 5 μl
[0035] h 2 O 42.5 μl
[0036] 37°C, 2 h.
[0037] 2) 1.5% agarose gel electrophoresis, using the QIAquick Gel Extraction Kit to recover DNA fragments from the gel.
[0038] 3) T4 DNA polymerase, so that step 2) includes synthetic poly (A), multiple cloning sites, luciferase reporter gene ( luc +) DNA fragments form blunt ends.
[0039] 4) 1.5% agarose gel electrophoresis, QIAquick Gel Extraction Kit, gel recovery DNA fragments.
[0040] 5) Srf I digest pBeloBAC11, the enzyme digestion system is
[0041] pBeloBAC11 vector 0.4 μg (1 μl)
[0042] BSA 0....
Embodiment 2
[0056] Example 2: Construction of pBeloBAC11-I1 reporter gene plasmid vector
[0057] 1) Use the pGL3-enhancer vector as a template to amplify the SV40 late poly(A) fragment by PCR. Primer F: 5'-CCCCC ACATGT CAGACATGATAAGATACATTGAT ( Pci I site underline ), Primer R: 5'-TTTTTT GGTAACC TACCACATTTGTAGAGGTTTTAC ( Bst EII site is underlined). PCR reaction system:
[0058] h 2 O 42 μl
[0059] 10X Pfu Buffer 5 μl
[0060] 10mM dNTP 1 μl
[0061] Template 100ng
[0062] Primers 0.2μl
[0063] Pfu 1 μl
[0064] Total 50 μl
[0065] PCR Conditions Adoption Procedure:
[0066] 95°C for 5 min; 95°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 2 min. The PCR products were electrophoresed in 2 μl gel, and the bands were clear and single.
[0067] 2) Purification step 1) PCR product. Add 5 μl of 5 M NH4Ac to the PCR product, after mixing, add 125 μl of 100% ethanol, -80°C, 4 h, 14,000 rpm, 4°C, 30 min. Discard the supernatant, add 0.3 ml of 70% e...
Embodiment 3
[0090] Example 3: Construction of pBeloBAC11-II plasmid
[0091] 1) From the pGL3-enhancer vector Bgl I / Sal I site digestion includes synthetic poly (A), multiple cloning site, luciferase reporter gene ( luc +) fragments. The enzyme digestion system is as follows:
[0092] pGL3-enhancer vector 0.4μg (1 μl)
[0093] BSA 0.5 μl
[0094] Bgl I 0.5 μl
[0095] Sal I 0.5 μl
[0096] 10×NEBBuffer 3 5 μl
[0097] h 2 O 42.5 μl
[0098] Temperature 37 degrees, 2 hours.
[0099] 2) 1.5% agarose gel electrophoresis, using the QIAquick Gel Extraction Kit to recover DNA fragments from the gel.
[0100] 3) T4 DNA polymerase, so that step 2) includes synthetic poly (A), multiple cloning sites, luciferase reporter gene ( luc +) DNA fragments form blunt ends.
[0101] 4) 1.5% agarose gel electrophoresis, QIAquick Gel Extraction Kit, gel recovery DNA fragments.
[0102] 5) T4DNA ligase ligation step 4) and Example 1 Step 6) got Srf I linearize the pBeloBAC11 vector, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


