Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method for function feed additive capable of resisting bird flu

A feed additive and functional technology, which is applied in the field of preparation of functional feed additives for poultry, can solve the problems of long immunization operation time, unsatisfactory effect and high production cost, and achieves no toxic and side residues, low production cost, and high cultivation. low cost effect

Inactive Publication Date: 2013-11-06
HENAN UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no really effective treatment for bird flu disease, and the treatment methods for animals infected with bird flu are mainly culling and burning, which has brought losses and inconvenience to the entire affected area
Although vaccination has played a positive role in the prevention and control of bird flu outbreaks and epidemics, the rapid mutation of bird flu virus has caused immune failure or unsatisfactory effects
Moreover, the vaccines currently used in the market are mainly traditional vaccines, which are prepared by cultivating and inactivating live viruses, which have the disadvantages of high cost, cumbersome operation, pollution to the environment, and the possibility of dispersing the virus.
[0003] In actual production, it takes a long time for the immunization operation to prevent the occurrence of bird flu through vaccines. For example, it takes about 3 days to immunize 10,000 chicken farms. If the number of breeding is larger, the operation time will be longer
At the same time, the production and use costs of vaccines are relatively high, the investment in breeding is large, and the production costs are high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for function feed additive capable of resisting bird flu
  • Preparation method for function feed additive capable of resisting bird flu
  • Preparation method for function feed additive capable of resisting bird flu

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] The basic operation techniques of genetic engineering used in the present invention are carried out according to the method provided in the "Refined Molecular Biology Experiment Guide (Fourth Edition)" published by Science Press in 2005, or according to the instructions for the purchased reagents and products.

[0029] A kind of preparation and application of the functional feed additive of anti-bird flu, its concrete steps are:

[0030] Step 1, preparation of engineering algae

[0031] (1) Cloning of H5N1 avian influenza HA gene fragment

[0032] According to the HA gene sequence of the H5N1 subtype avian influenza virus registered in GenBank, artificially synthesize the HA gene fragment (the gene sequence is shown in Sequence Listing 1), and design a pair of primers based on its gene sequence, the upstream primer p1: 5' TCTAGA ATGCGCAGCATGTCCATACCATA3', downstream primer p2: 5' GAGCTC AATGTGGATTCTTTGTCTGC 3', the underline refers to the introduction of upstream and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

A preparation method for a function feed additive capable of resisting bird flu comprises connecting parts of sections of artificially synthesized H5N1 bird flu virus hemagglutinin genes with eukaryotic expression vector protein bound idodine (pBI)-221 to obtain recombinant plasmid; converting the obtained recombinant plasmid in dunaliella through methods of particle guns, electric transform and the like to enable hemagglutinin to be expressed in the dunaliella; preparing to achieve engineering alga for expressing virus protein subunit; performing open expansion culture on the prepared engineering alga to collect alga bodies, and then obtaining the function feed additive capable of resisting bird flu through technological processes of low temperature drying, granulation and the like. The function feed additive prepared in the method is applied to poultry cultivation industries, has an immune protection function of resisting bird flu, can improve immune and growth speed poultry, has no side effects and is good in biological safety.

Description

technical field [0001] The invention relates to the field of feed additives, in particular to a preparation method of a functional feed additive for poultry with anti-avian influenza virus infection. Background technique [0002] Avian influenza disease is an acute and highly contagious disease of poultry caused by type A avian influenza virus, which can infect a variety of poultry, wild birds and mammals, and even spread to humans. At present, there is no really effective treatment method for bird flu disease, and the treatment methods for bird flu-infected animals are mainly culling and burning, which has brought losses and inconvenience to the entire affected area. Although vaccination has played a positive role in preventing and controlling the outbreak and prevalence of avian influenza, the rapid mutation of the avian influenza virus has caused immune failure or unsatisfactory effects. Moreover, the vaccines currently used in the market are mainly traditional vaccines,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/44C12R1/89
Inventor 冯书营王臣赵战勤李爱芳张小娟薛乐勋
Owner HENAN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products