Preparation method for function feed additive capable of resisting bird flu
A feed additive and functional technology, which is applied in the field of preparation of functional feed additives for poultry, can solve the problems of long immunization operation time, unsatisfactory effect and high production cost, and achieves no toxic and side residues, low production cost, and high cultivation. low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] The basic operation techniques of genetic engineering used in the present invention are carried out according to the method provided in the "Refined Molecular Biology Experiment Guide (Fourth Edition)" published by Science Press in 2005, or according to the instructions for the purchased reagents and products.
[0029] A kind of preparation and application of the functional feed additive of anti-bird flu, its concrete steps are:
[0030] Step 1, preparation of engineering algae
[0031] (1) Cloning of H5N1 avian influenza HA gene fragment
[0032] According to the HA gene sequence of the H5N1 subtype avian influenza virus registered in GenBank, artificially synthesize the HA gene fragment (the gene sequence is shown in Sequence Listing 1), and design a pair of primers based on its gene sequence, the upstream primer p1: 5' TCTAGA ATGCGCAGCATGTCCATACCATA3', downstream primer p2: 5' GAGCTC AATGTGGATTCTTTGTCTGC 3', the underline refers to the introduction of upstream and...
PUM
Property | Measurement | Unit |
---|---|---|
electrical resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap