Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for quickly identifying 11 tobacco types by utilizing RGP-3 specific molecular marker

An RGP-3, molecular marker technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of low sensitivity and accuracy, long growth period, affecting the process of tobacco breeding, etc. disease effects

Active Publication Date: 2012-07-11
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional identification methods of these wild resources often have a long growth period, which affects the tobacco breeding process; similarly, there are similar problems in the identification of intermediate materials
At present, although many molecular biology methods have been researched and developed for the rapid identification of crop germplasm resources, such as using AFLP and SSR, these methods have certain limitations in the germplasm identification of wild tobacco resources, and the sensitivity in the detection process and less accurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly identifying 11 tobacco types by utilizing RGP-3 specific molecular marker
  • Method for quickly identifying 11 tobacco types by utilizing RGP-3 specific molecular marker
  • Method for quickly identifying 11 tobacco types by utilizing RGP-3 specific molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A. Genomic DNA acquisition: Genomic DNA of K326 (N. tabacum (K326)) tobacco species was extracted with Qiagen Plant DNA Extraction Kit;

[0035] B. Primer design: Using the K326 tobacco genomic DNA obtained in step A as a template, after searching the GenBank database, according to the NsRGP-3 sequence (D67086) of Lin tobacco, use Primer 5.0 software to design a pair of specific primers including the coding region. Sexual primers, that is, the forward primer F-primer has the base sequence of 5' TGTCAATTTATCTGCACAAATG 3' and the reverse primer R-primer has the base sequence of 5' GCACGAAAAGAAGTCTTAATATA 3', and then completes the synthesis of the primers;

[0036] C, PCR amplification of genomic DNA: the tobacco genomic DNA extracted in step A is used as template DNA for PCR amplification; the PCR reaction system is 30 μl, including sterile water 19.3 μl, and does not contain MgCl 2 3.0 μl of 10×Taq DNA polymerase buffer with a concentration of 25 mM MgCl 2 2.5 μl, 2.0...

Embodiment 2

[0039] In this example, the genome DNA of N.tabacum (Hongda) tobacco was extracted, and the primers were designed and synthesized using the genome DNA, and the remaining methods and steps were the same as in Example 1.

Embodiment 3

[0041] In this example, the genomic DNA of N. glauca was extracted, and the primers were designed and synthesized using the genomic DNA, and the rest of the methods and steps were the same as those in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly identifying 11 tobacco types by utilizing a RGP-3 specific molecular marker. The 11 tobacco types are K326, hongda, N.sylvestris, N.glauca, N.goodspeedi, N.plumbaginifolia, N.repanda, N.rustica, N.clevelandii, N.undulata and N.alata. The method comprises the following steps of: extracting genome DNA of the 11 tobaccos, and taking the genome as a template; designing and synthesizing a RGP-3 primer to perform PCR (Polymerase Chain Reaction) amplification; and sequencing and identifying types with the amplified product. Compared with the prior art, the method has the functions of quickly identifying and detecting DNA molecules of the tobacco genome, and provides a scientific and efficient researching method for tobacco stress-resistance breeding research; when a bred type is used or produced illegally, the specific primer can be utilized for accurate identification, and becomes a strong evidence for solving a legal dispute; and reports on molecular marker identification of sources of the 11 tobacco sources are not found, so that foundation is established for molecular identification of different resource types of tobacco.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a method for quickly identifying 11 tobacco germplasms by using RGP-3 specific molecular markers. Background technique [0002] Tobacco is one of the important economic crops in our country. China is the largest tobacco producer in the world today, and the total output and sales of tobacco leaves account for about 50% of the world. At present, tobacco taxation has accounted for 1 / 10 of my country's fiscal revenue and occupies an important position in national economic revenue. However, with the change of cultivation conditions, tobacco pests and diseases are becoming more and more serious, causing huge economic losses. According to incomplete statistics, the annual direct economic loss caused by tobacco diseases in my country is more than 700 million yuan, and the application of wild tobacco resources in tobacco disease-resistant breeding has been paid more and more atte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 李文正陈璇黄夸克刘勇陈学军王丙武张家瑞邵岩
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com