Method for quickly identifying 11 tobacco types by utilizing RGP-3 specific molecular marker
An RGP-3, molecular marker technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of low sensitivity and accuracy, long growth period, affecting the process of tobacco breeding, etc. disease effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] A. Genomic DNA acquisition: Genomic DNA of K326 (N. tabacum (K326)) tobacco species was extracted with Qiagen Plant DNA Extraction Kit;
[0035] B. Primer design: Using the K326 tobacco genomic DNA obtained in step A as a template, after searching the GenBank database, according to the NsRGP-3 sequence (D67086) of Lin tobacco, use Primer 5.0 software to design a pair of specific primers including the coding region. Sexual primers, that is, the forward primer F-primer has the base sequence of 5' TGTCAATTTATCTGCACAAATG 3' and the reverse primer R-primer has the base sequence of 5' GCACGAAAAGAAGTCTTAATATA 3', and then completes the synthesis of the primers;
[0036] C, PCR amplification of genomic DNA: the tobacco genomic DNA extracted in step A is used as template DNA for PCR amplification; the PCR reaction system is 30 μl, including sterile water 19.3 μl, and does not contain MgCl 2 3.0 μl of 10×Taq DNA polymerase buffer with a concentration of 25 mM MgCl 2 2.5 μl, 2.0...
Embodiment 2
[0039] In this example, the genome DNA of N.tabacum (Hongda) tobacco was extracted, and the primers were designed and synthesized using the genome DNA, and the remaining methods and steps were the same as in Example 1.
Embodiment 3
[0041] In this example, the genomic DNA of N. glauca was extracted, and the primers were designed and synthesized using the genomic DNA, and the rest of the methods and steps were the same as those in Example 1.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap