Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof
A protein and soybean technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of affecting the appearance quality of soybeans, reducing soybean yield, threatening agricultural safety, etc., to enhance market competitiveness and meet the requirements of variety resistance , the effect of controlling the harm of SMV
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] (2) Through the software Oligo6, design specific primers for Rsv3C ( figure 2 ), the primer sequence is:
[0024] Upstream CGGAATTCCGAGCGACAAGTCATGGTAT;
[0025] Downstream TCCCCGCGGGGATATGAGGGGTGTTAGTGTCTGA;
[0026] (3) Precocious 18 soybeans were planted, about 5 grams of leaves were collected two weeks later, the genomic DNA was extracted by the improved CTAB method, and the concentration and purity of the obtained DNA were detected by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometer. Using genomic DNA as a template (concentration controlled at 20ng / μL), use the specific primers designed in step (2), use TAKARA's LA-Taq enzyme and supporting reagents, and use the Long-PCR method to amplify the NBS-LRR type Candidate gene Rsv3C. The PCR program used was: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, renaturation at 56°C for 45 seconds, extension at 68°C for 7 minutes, a total of 30 cycles, renaturation at 68°C for ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap