Engineering bacteria for generating gentamicin C1a and constructing method of engineering bacteria

A technology of gentamicin and its construction method, applied in the field of engineering bacteria producing gentamicin C1a and its construction, can solve the problems of unclear genetic background research of bacterial strains, etc., achieve clear genetic background of bacterial strains, increase yield, and quickly screen Effect

Active Publication Date: 2012-07-18
SHENYANG PHARMA UNIVERSITY
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method is not clear about the genetic background of the studied strains, and there may still be other C components of gentamicin in the fermentation products of the strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for generating gentamicin C1a and constructing method of engineering bacteria
  • Engineering bacteria for generating gentamicin C1a and constructing method of engineering bacteria
  • Engineering bacteria for generating gentamicin C1a and constructing method of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: gntK Construction of gene blocking plasmid

[0035] According to the published Micromonospora echinospora Design primers with corresponding sequence (GenBank accession number: AY524043):

[0036] Upstream primer of the left arm: K1 5’ -TCCAAGCTTGTACCCTCGGAGCCGGTCTTGT-3’ with Hin dⅢ restriction site;

[0037] Downstream primer of the left arm: K2 5’ –TGCTCTAGACTGGGTTGCGTCTGCGTGAT -3’ with Xba Ⅰ Restriction site; Amplify 1.3kb fragment P1;

[0038] Right arm upstream primer: K3 5’ -TGCTCTAGACGGGTAGAACGGGTTGGTCC -3’ with Xba Ⅰ restriction site;

[0039] Downstream primer of right arm: K4 5’ -CGGAATTCCAGCGTTGGCAATAATCATCAGC -3’ with Eco RⅠ restriction site; Amplify 1.5kb fragment P2.

[0040] Using the total DNA of Micromonospora purpurea as a template, the two fragments 1.3kb and 1.5kb were amplified by PCR, and the conservative sequence of 348bp within the gene was deleted. The conditions of the PCR reaction were: (1) 95℃ pre-denaturation for 5 minutes; ( 2) Melti...

Embodiment 2

[0041] Example 2: Blocking plasmid pMPK03 to transform Micromonospora crassa

[0042] Will contain ori The shuttle plasmid of T was transformed into E. coli ET12567 (pUZ8002), and the donor strain E. coli ET12567 (pUZ8002, donor plasmid) was obtained. A single colony of E. coli ET12567 (pUZ8002, donor plasmid) was inoculated in 3 ml of LB medium (adding action concentrations of 25 μg / ml kanamycin and chloramphenicol and 50 μg / ml donor plasmid corresponding antibiotics) Incubate overnight at 37°C, transfer 0.2% to 20 ml of LB medium containing three antibiotics, incubate at 37°C for 2.5~3.0 h, centrifuge to pellet the bacteria, wash twice with fresh LB medium, and finally The bacteria are suspended in about 7.5 ml of medium, and the microscopic examination count is about 10 8 Magnitude.

[0043] Prepare the single spore suspension of Micromonospora cristatum, wash it twice with 2×YT medium and dissolve it in a certain volume of 2×YT to make the concentration of single spore 10 8 ,...

Embodiment 3

[0045] Example 3: Screening of double exchange blocking strains

[0046] The transformants grown at 28°C were cultured at 37°C. Because the blocking plasmid cannot replicate at 42°C, the zygote will grow only after it is integrated into the chromosome through homologous exchange. Antibiotic resistance indicates that the zygote has undergone single exchange integration. The single exchange strains were uploaded to the drug-free plate for three generations, and 350 single colonies were picked and planted on the drug-containing and drug-free plates respectively. Two apramycin-sensitive strains were selected and the total DNA of the two strains was extracted. PCR verified that one of the strains was as big as the control, indicating that it had a single exchange and shedding; the other strain had a smaller fragment than the control, indicating that it had a double exchange. This strain was named M.purpurea gntK - .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of medicines and relates to engineering bacteria for mainly generating gentamicin C1a and a constructing method of the engineering bacteria. 6'-C-O-methyltransferase gntK in micromonospora echinospora of gentamicin generated bacteria is damaged by using a gene blocking technology, so that the synthesis of gentamicin C1, C2 and C2a is blocked and gentamicin C1a and small part of gentamicin C2b are mainly generated. The contents of the C1A, the C2, the C2a and C1 in an original strain are 6.5 percent, 45.3 percent, 20.1 percent and 27.1 percent respectively; and the contents of the C1a and the C2b in a blocked strain are 94.0 percent and 6.0 percent respectively. According to the constructing method, the gntK gene in the micromonospora echinospora is damaged by a method of deleting in the architecture to inactivate, including the construction of gntK gene blocking plasmid, conversion of the blocking plasmid into the micromonospora echinospora, screening of a double-exchange strain and analysis of a fermentation product. The engineering bacteria constructed by the constructing method provided by the invention have no resistant marker; and through continuous passage, the yield of the gentamicin C1a is very stable.

Description

[0001] Technical field [0002] The invention belongs to the field of antibiotic pharmacy, and relates to an engineered bacteria that mainly produces gentamicin C1a component and its construction method and application. It can be applied to the field of antibiotic pharmacy and has a large application space. Specifically, it relates to an engineered bacteria producing gentamicin C1a and a construction method thereof. Background technique [0003] Micromonospora is a genus of microorganisms that can produce a variety of clinically valuable antibiotics. Among the 60 micromonospora species reported successively, more than 40 produce antibiotics, including macrolides, aminoglycosides, Ansa and anthracyclines, etc. Micromonospora can not only produce antibiotics produced by Streptomyces, but also produce Gentamicin, Sisomicin, Astromivin, etc. Micromonospora has great potential and is receiving increasing attention. [0004] Gentamicin (Gentamicin, GM) is produced by the actinomycete g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N15/09C12N15/63C12P19/50C12R1/01
Inventor夏焕章倪现朴李昊
OwnerSHENYANG PHARMA UNIVERSITY