Fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on T7 exonuclease inhibition
An exonuclease and protein-binding technology, which is applied in the field of real-time fluorescence quantitative detection, can solve the problems of low sensitivity, poor reliability, and cannot meet the requirements of accurate and rapid detection of detection technology, and achieves the effects of quick and easy operation and simple design.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0025] Example 1: Detection of Indoleacetic Acid Based on T7 Exonuclease Inhibition Assay
[0026] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and indole acetic acid
[0027] Weigh 10 mg of indole acetic acid and dissolve in 2.5 mL of phosphate buffer solution (0.1 M NaH 2 PO 4 , pH 7.4), then added 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stirred at room temperature for 15min, then added 2.8mg
[0028] N-hydroxysuccinimide (NHS), reacted at room temperature for 30min. Take 260 μl of the activated indole acetic acid solution and add it to 260 μl of a concentration of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (TATATATGGTAGTGAGTAGTGAGGTTGTATAGTTT (NH2)AGTTGAGGTAGCGTG) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.
[0029] Transfer the cross-linked reactio...
Embodiment 2
[0032] Example 2: Detection of Folate-Binding Proteins Based on Restriction Enzyme Inhibition Assay
[0033] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA single strands and folic acid
[0034] Weigh 10 mg of folic acid and dissolve in 2.5 mL of phosphate buffer solution (0.1 M NaH 2PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate imide (NHS), react at room temperature for 30min. Take 260 μL of the activated folic acid solution and add it to 260 μL of a 10 μM intermediate amino-labeled oligonucleotide DNA single strand (TATATATGGTAGTGAGTAGTGAGGTTGTATAGTTT (NH2)AGTTGAGGTAGCGTG) solution, and react at room temperature for 2 h under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.
[0035] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a mo...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com