Fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on T7 exonuclease inhibition

An exonuclease and protein-binding technology, which is applied in the field of real-time fluorescence quantitative detection, can solve the problems of low sensitivity, poor reliability, and cannot meet the requirements of accurate and rapid detection of detection technology, and achieves the effects of quick and easy operation and simple design.

Active Publication Date: 2012-08-22
HUNAN UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These detection techniques have low sensitivity, poor reliability, and require sophisticated instruments, which cannot meet the needs of accurate and rapid detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Detection of Indoleacetic Acid Based on T7 Exonuclease Inhibition Assay

[0026] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and indole acetic acid

[0027] Weigh 10 mg of indole acetic acid and dissolve in 2.5 mL of phosphate buffer solution (0.1 M NaH 2 PO 4 , pH 7.4), then added 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stirred at room temperature for 15min, then added 2.8mg

[0028] N-hydroxysuccinimide (NHS), reacted at room temperature for 30min. Take 260 μl of the activated indole acetic acid solution and add it to 260 μl of a concentration of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (TATATATGGTAGTGAGTAGTGAGGTTGTATAGTTT (NH2)AGTTGAGGTAGCGTG) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.

[0029] Transfer the cross-linked reactio...

Embodiment 2

[0032] Example 2: Detection of Folate-Binding Proteins Based on Restriction Enzyme Inhibition Assay

[0033] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA single strands and folic acid

[0034] Weigh 10 mg of folic acid and dissolve in 2.5 mL of phosphate buffer solution (0.1 M NaH 2PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate imide (NHS), react at room temperature for 30min. Take 260 μL of the activated folic acid solution and add it to 260 μL of a 10 μM intermediate amino-labeled oligonucleotide DNA single strand (TATATATGGTAGTGAGTAGTGAGGTTGTATAGTTT (NH2)AGTTGAGGTAGCGTG) solution, and react at room temperature for 2 h under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.

[0035] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a mo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on a T7 exonuclease inhibition. The method comprises mutual action of an oligonucleotide DNA (Deoxyribonucleic Acid) single chain with the middle part modified by organic micromolecules and protein, selection of a T7 exonuclease inhibition site, and a real-time fluorescent quantitative detection technique based on a Taqman probe. The method provided by the invention can be used for detecting the mutual action of the organic micromolecules and the protein, and the organic micromolecules or conjugated protein thereof through the fluorescent real-time quantitative analysis of the Taqman probe subjected to enzyme digestion based on the inhibition effect of the mutual action of the organic micromolecules and the protein or an antibody to T7 exonuclease by utilizing the specific binding of the organic micromolecules modifying the middle part of the oligonucleotide DNA chain and the conjugated protein or antibody thereof. The method provided by the invention is high in sensitivity, simple and convenient in operation and strong in specificity, and can be used for signal transduction and molecule regulation and control mechanism research in biomedicine, food and farm product security detection, environmental poison detection,drug screening and the like.

Description

technical field [0001] The invention belongs to a biosensing technology for detecting the interaction between small organic molecules and binding proteins, which specifically refers to the interaction between oligonucleotide DNA chains and proteins modified in the middle of small organic molecules, the selection of inhibitory sites, T7 nucleic acid Exonuclease inhibition analysis, and real-time fluorescence quantitative detection method based on Taqman probe. Background technique [0002] The rapid screening and detection of small organic molecules such as interactions between small organic molecules and binding proteins, drugs and chemical toxins, and small organic molecule binding proteins are extremely useful for clinical diagnosis, medical research, food and public safety, drug screening, and environmental monitoring. Significance. At present, the commonly used detection techniques for the interaction between small molecules and binding proteins mainly include surface ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor甄珍蒋健晖楚霞唐丽娟俞汝勤
OwnerHUNAN UNIV