Novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof

A technology of Mycobacterium tuberculosis and fusion protein, applied in biochemical equipment and methods, hybrid peptides, specific peptides, etc., can solve the problems of low sensitivity and specificity, not exceeding 70%, and achieve high sensitivity, Effect of low cost, high antigen detection sensitivity and specificity

Inactive Publication Date: 2012-10-03
THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, other bacterial infections may also produce false positive reactions, resulting in the low sensitivity and specificity of the current commercial tuberculosis antibody detection kits. At present, the sensitivity of any single antigen for tuberculosis serological diagnosis has not exceeded 70%, no exact antigen or set of antigens can be recognized by all or most patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof
  • Novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof
  • Novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0032] The preparation method of the above-mentioned fusion protein Rv0057-Rv1352 comprises:

[0033] (1) Design of the fusion of two protein epitopes: After analyzing the gene sequence and protein structure of Mycobacterium tuberculosis Rv0057 and Rv1352, determine the fusion region, combination and sequence of the two protein epitopes; The antigenic epitopes are connected to form a fusion protein; the antigenic epitope of the Rv0057 protein is located at the amino terminal of the fusion protein, and the antigenic epitope of the Rv1352 protein is located at the shuttle base of the fusion protein. It consists of the key epitopes of two protein antigens, Rv0057 and Rv1352, connected sequentially, called Rv0057-Rv1352;

[0034] (2) Cloning of fusion of two proteins: Cloning by genetic engineering technology.

[0035] ①Add the Nhe I restriction site to the upstream primer of Rv0057, add the DNA sequence encoding 3 hydrophobic amino acids and Spe I and Xho I restriction sites to ...

Embodiment 1

[0039] 1. Cloning the Rv0057 antigen epitope coding gene by genetic engineering technology:

[0040] 1. Design and synthesize a pair of primers for amplifying the Rv0057 epitope according to the sequence 1 in the sequence listing

[0041] Upstream primer (5' end contains restriction endonuclease Nhe I)

[0042] 5'-CTAGCTAGCGTGGTGACCGCGGTCGG-3'

[0043] Downstream primer (contains restriction endonucleases Xho I and Spe I at the 5' end)

[0044] 5'-

[0045] CCGCTCGAGTTATTATTAACTAGTACCGCCACCGGTCATCAACGACCGCCA-3'

[0046] Amplified fragment: 555bp

[0047] 2. Rv0057 gene synthesis

[0048] According to the above design, the PCR product of Rv0057555bp was synthesized by gene, and the synthesized gene fragment was identified by 1.2% agarose gel electrophoresis. figure 1 It is the agarose electrophoresis image of the Rv0057 DNA fragment synthesized by the gene. The sequencing results prove that the DNA band indicated by the arrow in the figure is the position of the PCR produ...

Embodiment 2

[0188] The Rv0057-Rv1352 fusion protein constructed and purified in Example 1 of the present invention was applied to the serological diagnosis of tuberculosis. It is used as the diagnostic antigen of chemiluminescence immunoassay and applied to the test of clinical specimens, and a good diagnostic effect is obtained. Compared with the three currently commercialized tuberculosis antibody detection kits, it significantly improves the sensitivity of tuberculosis diagnosis. The ELISA detection procedure is as follows:

[0189] 1. Experimental specimens: A total of 103 serum specimens were selected and divided into two groups:

[0190] (1) Tuberculosis group: 54 patients with active tuberculosis diagnosed clinically by imaging, laboratory examination and anti-tuberculosis treatment, including 35 males and 19 females, with an average age of 43.1±18.8 years. Including tuberculosis, tuberculous pleurisy, tuberculous pericarditis, tuberculous meningitis, urinary tuberculosis, etc. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention relates to a novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof and belongs to the technical field of tuberculosis medical immunologic diagnosis. The fusion protein is formed by sequentially connecting antigenic epitopes of two proteins Rv0057 and Rv1352, wherein the nucleotide sequence of the antigenic epitope of the protein Rv0057 is shown in a sequence 1 in a sequence table; and the nucleotide sequence of the antigenic epitope of the protein Rv1352 is shown in a sequence 2 in a sequence table. Compared with the current commercial antibody detection kit, the mycobacterium tuberculosis specific fusion protein disclosed by the invention has the advantages of high sensitivity, strong specificity and complementarity with other antigens in the aspect of tuberculosis serodiagnosis, and can be used for detecting specific anti-tuberculosis antibodies in body fluid samples such as blood serum and pleural effusion.

Description

technical field [0001] The present invention relates to a novel Mycobacterium tuberculosis-specific fusion protein and its preparation and application, in particular to a novel Mycobacterium tuberculosis-specific fusion protein Rv0057-Rv1352 and its multi-antigen epitope prepared by genetic engineering technology. The preparation method belongs to the technical field of tuberculosis medical immunology detection. Background technique [0002] Tuberculosis is still one of the major infectious diseases that endanger human health in the world. Since 1985, the prevalence of AIDS, tuberculosis-infected immigrants and some people living in poverty have caused the incidence of tuberculosis to rise in the United States and other developed countries in Europe and the United States, especially tuberculosis. Bacterial drug resistance and co-infection with human immunodeficiency virus (HIV) make the treatment of tuberculosis even worse. At present, there are about 20 million tuberculosi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/70G01N33/68C12R1/32
Inventor 吴雪琼阳幼荣梁艳赵卫国冯金栋张俊仙
Owner THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap