Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding
A screening marker and transgenic technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as ecological environment food safety problems, and achieve the effect of avoiding harm to the ecological environment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The construction of embodiment 1pJAM-root-Ros / DEL expression vector
[0031] Build strategies such as figure 1 shown.
[0032] 1. PCR amplification of Arabidopsis root-specific promoter ATH-root
[0033] According to the sequence of the Arabidopsis root-specific promoter ATH-root, a pair of primers specific to the target fragment were designed using the Primer5.0 software. The primer sequences are as follows:
[0034] ATH-root-up: TACCACGGTCTCGAATTGCC (SEQ ID No. 1)
[0035] ATH-root-low:CGTCTTAATGACCCCGGTC (SEQ ID No. 2)
[0036] The program of PCR reaction is set as follows:
[0037]
[0038] PCR amplification, 25μl PCR reaction system is as follows:
[0039]
[0040] 2. Construction of pGWC-root intermediate vector
[0041] The multiple cloning site of the vector pGWC contains an AhdⅠ restriction site, which is digested by the enzyme Eam1105 to form a large fragment of the vector with T at both ends. After recovery, it is ligated with the promoter fragmen...
Embodiment 2
[0060] Example 2 Genetic Transformation of Anthocyanin Regulation Genes in Ground Cover Chrysanthemum
[0061] Using the Agrobacterium-mediated genetic transformation method, the genome vector was introduced into the leaf explants of the ground cover chrysanthemum variety 'Fenrug', and finally 4 positive plants of Rosea 1 and Delila were obtained.
[0062] Genomic DNA was extracted from the obtained resistant rooted shoots, primers were designed with the sequences of NPT II gene and Rosea 1 gene, and PCR detection was performed on NPT II gene and Rosea 1 gene respectively ( image 3 ) and PCR-Southern detection ( Figure 4 ), as a result, the vector pJAM-root-Ros / Del was transformed into 'pink carpet' explants, and a total of 4 PCR-Southern positive plants were obtained ( Figure 4 ), the positive rate was 8.9%, and the conversion rate was 3.3‰.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 