Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding

A screening marker and transgenic technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as ecological environment food safety problems, and achieve the effect of avoiding harm to the ecological environment

Inactive Publication Date: 2014-04-09
BEIJING FORESTRY UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of genetic transformation, the marker genes used will cause potential ecological environment and food safety problems, so the use of safety marker genes or removal of selection markers has become an important goal and development trend of genetic engineering breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding
  • Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding
  • Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The construction of embodiment 1pJAM-root-Ros / DEL expression vector

[0031] Build strategies such as figure 1 shown.

[0032] 1. PCR amplification of Arabidopsis root-specific promoter ATH-root

[0033] According to the sequence of the Arabidopsis root-specific promoter ATH-root, a pair of primers specific to the target fragment were designed using the Primer5.0 software. The primer sequences are as follows:

[0034] ATH-root-up: TACCACGGTCTCGAATTGCC (SEQ ID No. 1)

[0035] ATH-root-low:CGTCTTAATGACCCCGGTC (SEQ ID No. 2)

[0036] The program of PCR reaction is set as follows:

[0037]

[0038] PCR amplification, 25μl PCR reaction system is as follows:

[0039]

[0040] 2. Construction of pGWC-root intermediate vector

[0041] The multiple cloning site of the vector pGWC contains an AhdⅠ restriction site, which is digested by the enzyme Eam1105 to form a large fragment of the vector with T at both ends. After recovery, it is ligated with the promoter fragmen...

Embodiment 2

[0060] Example 2 Genetic Transformation of Anthocyanin Regulation Genes in Ground Cover Chrysanthemum

[0061] Using the Agrobacterium-mediated genetic transformation method, the genome vector was introduced into the leaf explants of the ground cover chrysanthemum variety 'Fenrug', and finally 4 positive plants of Rosea 1 and Delila were obtained.

[0062] Genomic DNA was extracted from the obtained resistant rooted shoots, primers were designed with the sequences of NPT II gene and Rosea 1 gene, and PCR detection was performed on NPT II gene and Rosea 1 gene respectively ( image 3 ) and PCR-Southern detection ( Figure 4 ), as a result, the vector pJAM-root-Ros / Del was transformed into 'pink carpet' explants, and a total of 4 PCR-Southern positive plants were obtained ( Figure 4 ), the positive rate was 8.9%, and the conversion rate was 3.3‰.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding. The Rosea 1 and the Delila, which serve as antirrhinum anthocyanidin regulator genes, can generate visual markers in a chrysanthemum stem after transferred to a chrysanthemum, so that transgenic and non-transgenic plants are distinguished. In chrysanthemum transgenic engineering, the genes can be used for substituting for antibiotic marker genes, so that damage of marker genes such as antibiotic to the ecological environment is avoided.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of chrysanthemum visual marker genes Rosea 1 and Delila in transgenic breeding of chrysanthemums. Background technique [0002] Chrysanthemum is a traditional famous flower in my country, which has important ornamental value and economic value. At present, due to its great advantages, transgenic engineering technology is becoming an important means of ornamental plant breeding. However, in the process of genetic transformation, the marker genes used will cause potential ecological environment and food safety problems, so the use of safety marker genes or removal of selection markers has become an important goal and development trend of genetic engineering breeding. [0003] The safety of marker genes has been a hot spot in the world in recent years. Up to now, there are two main strategies to solve the safety of transgenic plants: 1. Developme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00
Inventor 高亦珂石少川张秀海张启翔王叶程堂仁
Owner BEIJING FORESTRY UNIVERSITY