Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing recombinant mixed L-arabinose isomerase

An arabinose and isomerase technology, applied in the biological field, can solve problems such as L-arabinose isomerase has not yet been discovered, affecting the development of D-tagatose industry, etc.

Inactive Publication Date: 2012-10-10
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a variety of microorganisms have the function of producing L-arabinose isomerase, so far no L-arabinose isomerase that meets the optimum pH 5.0-6.0 and optimum temperature > 60°C has been found, which affects the use Development of D-tagatose Production by L-Arabinose Isomerase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing recombinant mixed L-arabinose isomerase
  • Method for producing recombinant mixed L-arabinose isomerase
  • Method for producing recombinant mixed L-arabinose isomerase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] 1.1 Construction of the L-arabinose isomerase gene expression framework containing Thermotoga neoapollinum, the L-arabinose isomerase gene expression framework of Bacillus stearothermophilus and the L-arabinose isomerase gene of Escherichia coli Expression framework for Pichia expression vector

[0020] 1.1.1 Construction of cloning vector

[0021] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPL.

[0022] 1.1.2 Acquiring genes

[0023] ①PCR amplification of the L-arabinose isomerase gene of Thermotoga neoapollianus

[0024] Primer 1:

[0025] 5'cc GAATTC atgatcgatctcaaacagtat3'[Description: The 8 bases of 5' are the restriction enzyme protection bases...

Embodiment 2

[0081] 2.1 Construction of the L-arabinose isomerase gene expression framework containing Thermotoga neoapollinum, the L-arabinose isomerase gene expression framework of Bacillus stearothermophilus and the L-arabinose isomerase gene of Escherichia coli Expression framework for Pichia expression vector

[0082] 2.1.1 Construction of cloning vector

[0083] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPL.

[0084] 2.1.2 Acquiring genes

[0085] ①PCR amplification of the L-arabinose isomerase gene of Thermotoga neoapollianus

[0086] Primer 1:

[0087] 5'cc GAATTC atgatcgatctcaaacagtat3'[Description: The 8 bases of 5' are the restriction enzyme protection bases...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing recombinant mixed L-arabinose isomerase and belongs to the field of biological technology. The method comprises the steps of: first, cloning L-arabinose isomerase genes of bacillus stearothermophilus, thermotoga neapolitana and escherichia coli; constructing a pichia pastoris expression vector containing expression frameworks of the three L-arabinose isomerase genes and converting the vector into pichia pastoris to obtain engineering bacteria; and fermenting the pichia pastoris engineering bacteria to produce the recombinant mixed L-arabinose isomerase. The recombinant mixed enzyme has much higher enzymatic activity than a single enzyme with pichia pastoris as an expression vector, and has high enzymatic activity for isomerizing D-galactose into D-tagatose at a pH of 6.0 and at a temperature of 80 DEG C, which meet the production condition of isomerizing D-galactose into D-tagatose. The method provided by the invention is conducive to the solution of the problem that development of the industry of producing D-tagatose by an enzymic method is constrained as there is no L-arabinose isomerase that meets the requirements of an optimum pH of 5.0-6.0 and an optimum temperature of above 45 DEG C to produce bacterial strains, and thus helps promote the industry of producing D-tagatose by an enzymic method.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the construction of microbial engineering bacteria to produce recombinant proteins. Specifically, the recombinant mixed L-arabinose isomerase is produced by using microbial engineering bacteria. Background technique [0002] L-arabinose isomerase (L-arabinose isomerase EC 5.3.1.4) is an allosteric enzyme produced by microorganisms. L-arabinose isomerase can catalyze L-arabinose to L-ribulose; due to the structural similarity between L-arabinose and D-galactose, L-arabinose isomerase can also catalyze D-galactose Isomerized to D-tagatose. D-tagatose is a sweetener with low-energy, blood sugar-lowering and anti-caries properties. Although a variety of microorganisms have the function of producing L-arabinose isomerase, the current tagatose products are still mainly derived from chemical synthesis. The process of chemically synthesizing D-tagatose is complicated, the production price i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/61C12N15/81C12N1/19C12N9/90C12P19/24C12R1/84
Inventor 张爱联尹慧祥陈丽萍崔艳艳张添元
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI