Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein

A fusion protein and enterovirus technology, applied in the biological field, can solve the problems of difficulty in evaluating the anti-EV71 effect of drugs, complicated operation, and lack of evaluation system

Inactive Publication Date: 2012-11-07
HARBIN MEDICAL UNIVERSITY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In addition to the traditional virus culture and identification method, the current methods for observing and detecting EV71 are mainly RT-PCR and immunological methods, but these methods are relatively complicated in operation and cannot directly observe the changes of the virus in cells or tissues, especially It is the infection of EV71 in the body, and the lack of an ideal evaluation system makes it difficult to evaluate the anti-EV71 effect of drugs, which greatly delays the development and screening of drugs. Therefore, it is imminent to establish an ideal screening and evaluation system for anti-EV71 drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein
  • Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein
  • Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The construction of embodiment 1 fusion protein ANluc (△ Q / G) BCluc-EGFP eukaryotic expression vector

[0063] 1.1 Construction of pCDNA3.1(+)-EGFP plasmid platform

[0064] First, remove the multiple cloning site in the plasmid pEGFP-N1 (purchased from Clontech, USA) to construct the plasmid pEGFP-N1', then amplify the CMV-EGFP-SV40 fragment, and insert the fragment reversely into pCDNA3.1(+) (purchased from Invitrogen, USA) with multiple cloning sites to construct the vector plasmid pCDNA3.1(+)-EGFP.

[0065] According to the cDNA sequence of EGFP (Genebank number: GI1377911), the primer sequence for PCR amplification of the EGFP gene fragment was designed as follows:

[0066] P1 (upstream primer): 5'-ATATATGCTAGCATGGTGAGCAAGGGCGAGGA-3'

[0067] P2 (downstream primer): 5'-ATATAGCGGCCGCTTACTTGTACAGCTCGTCCA-3'

[0068] The primer sequences for amplifying the CMV-EGFP-SV40 fragment are as follows:

[0069] P3 (upstream primer):

[0070] 5'-GCGCGCTCGAGTAGTTATTAATAGTA...

Embodiment 2

[0097] Example 2 The use of intracellular transfection to express the carrier of the EV713C protein to verify the effect of the fusion protein

[0098] 1. Construction of vector pEGFP-3C

[0099] 1.1 Construction of pEGFP-C1 plasmid platform

[0100] Using pcDNA3.1 (+) (purchased from Invitrogen, USA) as the basic plasmid backbone, the EGFP nucleic acid fragment with a flexible link at the 3' end was amplified from the pEGFP-N1 plasmid (purchased from Invitrogen, USA), and the green fluorescent protein EGFP The gene fragment was inserted into the pcDNA3.1 (+) plasmid to construct the pEGFP-C1 plasmid platform.

[0101] According to the cDNA sequence design of EGFP (Genebank number: GI1377911), the 3' end of PCR amplification was designed with a flexible linker (5'GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG3')

[0102] The primer sequence of the EGFP gene fragment is as follows:

[0103] P9 (upstream primer): 5'-ATATATAGCTAGCATGGTGAGCAAGGGCGAGGAGCT-3'

[0104] P10 (downst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses fusion protein for screening and evaluating an anti-enterovirus 71 (EV 71) medicine and application of the fusion protein. According to the fusion protein, firefly luciferase (Fluc) is used as a reporter gene, two micromolecule polypeptides which can be bonded tightly pepA and pepB are bonded with the N end and the C end of the firefly luciferase respectively, the middles of the firefly luciferase are connected by an EV713C protease effect substrate, and a fusion gene is inserted into an eukaryotic expression vector and is expressed to generate the fusion protein. Simultaneously, enhanced green fluorescent protein (EGFP) which is inserted reversely can indicate the transfection efficiency of the EGFP in cells which are transfected in vitro by observing the condition of green fluorescence. By utilizing an indication vector provided by the fusion protein, the reproduction condition of EV 71 can be indicated simply, quickly, flexibly and quantitatively, and the indication vector also can be applied to the screening and evaluation of the anti-EV 71 medicine, has high actual application value and has a broad application prospect in the field of medical science.

Description

technical field [0001] The invention relates to a fusion protein for screening and evaluating drugs and its application, in particular to a fusion protein for screening and evaluating anti-EV71 drugs based on a chemiluminescence method and its application. Belongs to the field of biotechnology. Background technique [0002] Enterovirus 71 (enterovirus 71, EV71) is an important neuroinfectious enterovirus, and currently there is no effective treatment and vaccine. There are reports of outbreaks of infectious diseases associated with EV71 virus infection in the Asia-Pacific region and around the world (AbuBakar, S., et al.. Enterovirus71 outbreak, Brunei. Emerg. Infect. Dis. 2009, 15:79-82.) . EV71 infection mainly causes a rash in children known as hand-foot-mouth disease (HFMD). However, acute infection with EV71 can also cause severe neurological disease and high mortality. In particular, EV71 infection in children under five years of age has been associated with neurol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/85C12N15/66C12N5/10C12Q1/66C12Q1/37C12Q1/70C12Q1/68C12R1/93
Inventor钟照华林乐勋郭志伟佟雷赵文然
OwnerHARBIN MEDICAL UNIVERSITY