Bt protein Cry4Cb2, encoding gene of same and use thereof
A cry4cb2, bt protein technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The cloning of embodiment 1Cry4Cb2 gene
[0029] The present invention is isolated from the new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) obtained from the plain soil of Chengdu, Sichuan Province. No. 3, Datun Road, Institute of Microbiology, Chinese Academy of Sciences, Zip code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2860.
[0030] In this example, the full-length sequence of the Cry4Cb2 gene was cloned by the following method.
[0031] The total DNA of strain HS18-1 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:
[0032] P1: 5'ATGTCTAATCGTTATCAACGGTACCC 3'
[0033]P2: 5'TCACTCGTTCATACAAATCAACTCGA 3'
[0034] PCR reaction system:
[0035]
[0036] Thermal cycle reaction: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, a...
Embodiment 2
[0037] Expression and insecticidal activity of embodiment 2Cry4Cb2 gene
[0038] According to the sequence at both ends of the open reading frame of the cry4Cb2 gene, a pair of specific primers cry4F: 5′-GCG was designed and synthesized CATATG (NdeI) ATGTCTAATCGTTATCAACGGTACCC-3'; cry4R: 5'-CG GAATTC (EcoR I) TCACTCGTTCATACAAATCAACTCGA-3', respectively at the 5' end primers Nde I and EcoR I restriction sites. The BtMC28 plasmid was used as a template to amplify, and the amplified product was double-digested with Nde I and EcoR I, and the digested product was ligated with the vector pET-30a(+) after the same double-digestion, and transformed into E.coli DH5α sensory state cells, extract their plasmids and electrophoresis to verify that the size of the inserted fragment meets the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named pET-4Cb, and the recombinant containing the recombinant plasmid wa...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
