Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular classification and identification method for fish eggs

A technology for molecular identification and fish roe, which is applied in biochemical equipment and methods, and microbial measurement/inspection. Simple operation, accurate classification and identification

Inactive Publication Date: 2013-01-09
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the highly similar morphology of some fish eggs, the overlap of spawning periods and spawning areas, and the lack of reliable identification data, it is very difficult to accurately identify the species of fish eggs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0010] Below in conjunction with embodiment, the present invention is described further, but the present invention is not limited to following embodiment.

[0011] A fish egg classification molecular identification method adopts the following steps:

[0012] 1. Obtain fish samples that can be accurately classified and identified through on-site fishing and market purchases in the surveyed waters, fix them with 95% ethanol, and bring them back to the laboratory for storage at -4°C for later use;

[0013] 2. Take about 100 mg of muscle from the above-mentioned fish sample and put it into a 1.5 ml Eppendorf tube, and extract it by the conventional phenol-chloroform method referring to the third edition of "Molecular Cloning Experiment Guide" (J. Sambrook, D.W. Russell). Sample total DNA;

[0014] 3. Select the CO I gene as the characteristic fragment, and use PCR amplification, the upstream primer (5′-3′): AGTATAAGCGTCTGGGTAGTC, the downstream primer (5′-3′): CCTGCAGGAGGAGAYCC, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular classification and identification method for fish eggs. The molecular classification and identification method for fish eggs includes: firstly, respectively extracting DNAs (deoxyribonucleic acids) of fishes in an investigated water area, selecting cytochrome oxidase subunits I (COI) in the mitochondrial DNAs as featured fragments, performing amplification and sequencing, and establishing a DNA fingerprinting database of the mitochondrial (COI) DNAs; and secondly, extracting DNAs of the fish eggs to be identified, amplifying the COI genes and sequencing, and comparing the sequences to sequences in the fingerprinting database so as to identify the categories of the fish eggs. The molecular classification and identification method for fish eggs is simple to operate and accurate in classification and identification.

Description

technical field [0001] The invention relates to a fish egg classification molecular identification method, which can quickly and accurately classify and identify fish eggs that are difficult to identify in morphology, and belongs to the technical field of fishery resources. Background technique [0002] Fish eggs record many early developmental life history characteristics of fish and related ecological information, which is of great significance in the fields of environmental assessment, analysis of fishery resources, proliferation and release of fishery resources, and breeding. Accurate identification of fish egg species is the basis for studying fish life history and fish resource assessment. On the one hand, the accurate identification of fish roe species is the premise of fishery resources assessment; on the other hand, the early development of fish is closely related to the early replenishment mechanism of fishery resources. Therefore, more and more scholars have begu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 张敏莹施炜纲徐东坡刘凯周彦锋段金荣方第安
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More