Molecular classification and identification method for fish eggs
A technology for molecular identification and fish roe, which is applied in biochemical equipment and methods, and microbial measurement/inspection. Simple operation, accurate classification and identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0010] Below in conjunction with embodiment, the present invention is described further, but the present invention is not limited to following embodiment.
[0011] A fish egg classification molecular identification method adopts the following steps:
[0012] 1. Obtain fish samples that can be accurately classified and identified through on-site fishing and market purchases in the surveyed waters, fix them with 95% ethanol, and bring them back to the laboratory for storage at -4°C for later use;
[0013] 2. Take about 100 mg of muscle from the above-mentioned fish sample and put it into a 1.5 ml Eppendorf tube, and extract it by the conventional phenol-chloroform method referring to the third edition of "Molecular Cloning Experiment Guide" (J. Sambrook, D.W. Russell). Sample total DNA;
[0014] 3. Select the CO I gene as the characteristic fragment, and use PCR amplification, the upstream primer (5′-3′): AGTATAAGCGTCTGGGTAGTC, the downstream primer (5′-3′): CCTGCAGGAGGAGAYCC, ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com