Chlamydia pneumonia antigen, method for preparing antigen, fast detection method and reagent for detecting anti-chlamydia pneumonia antibody by utilizing antigen
A Chlamydia pneumoniae and antigen technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, biological testing, etc., can solve the clinical needs of rapid detection of Chlamydia pneumoniae, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0051] 1) Recombinant expression, structure renaturation and purification of recombinant Chlamydia pneumoniae MOMP antigen
[0052] The MOMP gene of Mycoplasma pneumoniae was synthesized with reference to the GenBank sequence M64064. During the synthesis, the signal peptide sequence was removed and the rare codons of Escherichia coli were optimized, and the enzyme cutting site BamHI / XhoI was introduced. A total of 1101bp (366aa) was synthesized for the target gene.
[0053] gene synthesis sequence
[0054] >CpnMOMPSequence
[0055] GGC GGATCC TTGCCTGTAGGTAACCCTTCTGATCCAAGCTTATTAATTGATGGTACAATCTGGGAGGGTGCTGCAGGTGATCCTTGCGATCCTTGCGCTACTTGGTGCGACGCTATTAGCTTACGTGCTGGTTTTTACGGTGACTATGTTTTCGACCGTATCTTAAAAGTAGATGCACCTAAAACATTTTCTATGGGTGCCAAGCCTACTGGTTCCGCTGCTGCAAACTATACTACTGCCGTAGATCGTCCTAACCCGGCCTACAATAAGCATTTACACGATGCAGAGTGGTTCACTAATGCAGGCTTCATTGCCTTAAACATTTGGGATCGCTTTGATGTTTTCTGTACTTTAGGTGCTTCTAATGGTTACATTCGTGGTAACTCTACAGCGTTCAATCTCGTTGGTTTATTCGGTGTTAAAGGTACTACTGTAAATGCAAATGAAC...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com