Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chlamydia pneumonia antigen, method for preparing antigen, fast detection method and reagent for detecting anti-chlamydia pneumonia antibody by utilizing antigen

A Chlamydia pneumoniae and antigen technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, biological testing, etc., can solve the clinical needs of rapid detection of Chlamydia pneumoniae, etc.

Inactive Publication Date: 2013-01-23
李克生
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, although detection methods for Chlamydia pneumoniae antibodies have been established, they cannot meet the clinical needs of rapid detection of Chlamydia pneumoniae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlamydia pneumonia antigen, method for preparing antigen, fast detection method and reagent for detecting anti-chlamydia pneumonia antibody by utilizing antigen
  • Chlamydia pneumonia antigen, method for preparing antigen, fast detection method and reagent for detecting anti-chlamydia pneumonia antibody by utilizing antigen
  • Chlamydia pneumonia antigen, method for preparing antigen, fast detection method and reagent for detecting anti-chlamydia pneumonia antibody by utilizing antigen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0051] 1) Recombinant expression, structure renaturation and purification of recombinant Chlamydia pneumoniae MOMP antigen

[0052] The MOMP gene of Mycoplasma pneumoniae was synthesized with reference to the GenBank sequence M64064. During the synthesis, the signal peptide sequence was removed and the rare codons of Escherichia coli were optimized, and the enzyme cutting site BamHI / XhoI was introduced. A total of 1101bp (366aa) was synthesized for the target gene.

[0053] gene synthesis sequence

[0054] >CpnMOMPSequence

[0055] GGC GGATCC TTGCCTGTAGGTAACCCTTCTGATCCAAGCTTATTAATTGATGGTACAATCTGGGAGGGTGCTGCAGGTGATCCTTGCGATCCTTGCGCTACTTGGTGCGACGCTATTAGCTTACGTGCTGGTTTTTACGGTGACTATGTTTTCGACCGTATCTTAAAAGTAGATGCACCTAAAACATTTTCTATGGGTGCCAAGCCTACTGGTTCCGCTGCTGCAAACTATACTACTGCCGTAGATCGTCCTAACCCGGCCTACAATAAGCATTTACACGATGCAGAGTGGTTCACTAATGCAGGCTTCATTGCCTTAAACATTTGGGATCGCTTTGATGTTTTCTGTACTTTAGGTGCTTCTAATGGTTACATTCGTGGTAACTCTACAGCGTTCAATCTCGTTGGTTTATTCGGTGTTAAAGGTACTACTGTAAATGCAAATGAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a chlamydia pneumonia genetic engineering expression artificial antigen, and a method for preparing the antigen. The method comprises the steps of: cloning and amplifying a chlamydia pneumonia MOMP (major outer membrane protein) antigen gene sequence by PCR (polymerase chain reaction), building a prokaryotic expression vector, expressing chlamydia pneumonia MOMP antigen protein by escherichia coli, and obtaining a reconstructed chlamydia pneumonia MOMP antigen with a three-dimensional structure and immunological competence by a dialysis method, a gradient dilution method and a gel chromatography renaturation inclusion body. A fast detection method for detecting the chlamydia pneumonia antigen antibody is provided. The method comprises the application of the chlamydia pneumonia antigen; and the invention provides a fast detection reagent for detecting the chlamydia pneumonia antibody. The reagent contains the chlamydia pneumonia antigen. According to the invention, the chlamydia pneumonia antigen is provided. The antigen has high specificity. The method for preparing the antigen, the method for fast measuring the chlamydia pneumonia antibody, and the reagent for fast measuring the chlamydia pneumonia antibody are provided by the invention.

Description

technical field [0001] The invention relates to a chlamydia pneumoniae antigen for diagnosing chlamydia pneumoniae infection, a method for preparing the antigen, a method for measuring anti-chlamydia pneumoniae antibodies using the antigen and a reagent. [0002] The invention has important significance in the diagnosis of atypical pneumonia caused by chlamydia pneumoniae. Background technique [0003] Chlamydia is a Gram-negative, obligate intracellular parasite. Can propagate in human alveolar macrophages, epithelial cells, endothelial cells, smooth muscle cells, neutrophils. Its growth has a unique cycle. Chlamydia primary bodies (EB) located outside the cells are ingested into the cells to form inclusion bodies, and then transformed into reticulosomes (RB). RB has the ability to reproduce but not to infect. The RB that propagates in the cell is quickly transformed into EB, and penetrates the inclusion body and cell wall to reach the outside of the cell. EB is non-repr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/295C12N15/70G01N33/68G01N33/558C12R1/35
Inventor 李克生杜慧芬周海飞
Owner 李克生
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More