Unlock instant, AI-driven research and patent intelligence for your innovation.

Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof

A technology for detection of Peste des petits ruminants and antibodies, applied in the biological field, can solve the problems of low antibody titer and achieve good specificity

Active Publication Date: 2013-03-13
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using this method to detect hyperimmune serum immunized with RPV, when VNT ≥ 1:512, the test result is positive, but the antibody titer shown is very low, only 1:2-1:16

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof
  • Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof
  • Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] 1. Preparation of recombinant N protein antigen of Peste des petits ruminants

[0023] Design N gene primers, N-UP: 5′CGGAATTCATGGCTACTTCCTCTTAAAAGCT 3′, N-DN: 5′ACGCGTCGACTTAGCTGAGGAGATCCTTGT3′, respectively introduce enzyme cutting sites EcoR I and Sal I at the 5′ ends of the upstream and downstream primers; through RT-PCR method The ORF of N gene was obtained from veterinary cytotoxic RNA, and its prokaryotic expression vector pGEX-4T-1 was constructed. The recombinant plasmid was transformed into BL-21 host bacteria, under the induction of IPTG, it was highly expressed and the protein antigen was extracted.

[0024] 2. Preparation and identification of monoclonal antibody against PPRV N protein

[0025] 1 material

[0026] 1.1 Antigens, cell lines and experimental animals

[0027] Antigen: prokaryotic expression and purification of recombinant GST-N, PPRV vaccine strain; cell line: SP2 / 0 strain myeloma cells, preserved by Lanzhou Veterinary Research Institute; expe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

Belonging to the field of biotechnologies, the invention discloses a competitive ELISA kit for detection of a peste-des-petits-ruminants virus antibody. The kit comprises a detection system composed of a coating antigen reaction solution and a monoclonal antibody reaction solution. The kit adopts prokaryotically expressed peste-des-petits-ruminants Nigeria 75 / 1 strain N protein as the coating antigen and employs a monoclonal antibody against N protein as the competitive antibody. The antibody against a peste-des-petits-ruminants virus in sheep serum is detected according to a competitive ELISA principle. The kit provided in the invention can rapidly and specifically detect the peste-des-petits-ruminants virus antibody in serum, and simultaneously has the advantages of large-scale production of monoclonal antibodies, good reaction specificity, high sensitivity, simple operation, low cost, stable, reliable and easily observable reaction results, thus being very suitable for import and export quarantine of sheep, food hygiene and screening of large batches of samples in livestock breeding farms, and being easy for large-scale popularization and application.

Description

technical field [0001] The invention discloses a competition ELISA kit for detecting Peste des petits ruminants virus antibody and a preparation method thereof. The kit includes a detection system composed of a coating antigen reaction solution and a monoclonal antibody reaction solution, and belongs to the field of biotechnology. Background technique [0002] Peste des petits ruminants is an acute, virulent, and contagious Class A infectious disease that can infect goats, sheep, fawn gazelles, and longhorn antelopes. . Since its discovery in 1940, the disease has been prevalent in most African countries, the Arabian Peninsula, Israel, Syria, Iraq, Jordan, Turkey and other Middle East regions, as well as the Indian Peninsula in South Asia. In the past, because the disease did not exist in our country, there were very few studies on it. On July 26, 2007, my country reported for the first time that an epidemic of Peste des petits ruminants occurred in Longmenka Village, Reba...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/577G01N33/543C12N15/70C07K16/10
Inventor 才学鹏窦永喜蒙学莲毛立李辉骆学农
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More