Competitive ELISA kit for peste-des-petits-ruminants antibody detection and preparation method thereof
A technology for detection of Peste des petits ruminants and antibodies, applied in the biological field, can solve the problems of low antibody titer and achieve good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] 1. Preparation of recombinant N protein antigen of Peste des petits ruminants
[0023] Design N gene primers, N-UP: 5′CGGAATTCATGGCTACTTCCTCTTAAAAGCT 3′, N-DN: 5′ACGCGTCGACTTAGCTGAGGAGATCCTTGT3′, respectively introduce enzyme cutting sites EcoR I and Sal I at the 5′ ends of the upstream and downstream primers; through RT-PCR method The ORF of N gene was obtained from veterinary cytotoxic RNA, and its prokaryotic expression vector pGEX-4T-1 was constructed. The recombinant plasmid was transformed into BL-21 host bacteria, under the induction of IPTG, it was highly expressed and the protein antigen was extracted.
[0024] 2. Preparation and identification of monoclonal antibody against PPRV N protein
[0025] 1 material
[0026] 1.1 Antigens, cell lines and experimental animals
[0027] Antigen: prokaryotic expression and purification of recombinant GST-N, PPRV vaccine strain; cell line: SP2 / 0 strain myeloma cells, preserved by Lanzhou Veterinary Research Institute; expe...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 