Detection method for sulfate reducing bacteria
A sulfate and desulfurization enteric bacteria technology, applied in the field of microbial detection and identification, can solve the problems of long detection cycle, measurement error, difficult cultivation and separation, etc.
Active Publication Date: 2015-05-20
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Therefore, the detection of sulfate-reducing bacteria according to the aforementioned three traditional methods has the following defects: for sulfate-reducing bacteria with low abundance, there may be missed detection; resulting in missed detection; long detection cycle, large consumption, and heavy workload; methods such as microscopy cannot effectively distinguish sulfate-reducing bacteria, resulting in large measurement errors; for thermophilic sulfate-reducing bacteria and non-thermophilic sulfate Reducing bacteria cannot be effectively distinguished, resulting in errors in the detection of thermophilic bacteria; the environment (such as oil reservoirs) is bred with rich and diverse microorganisms, and most of them grow in deep formations and are difficult to cultivate and isolate. , These microorganisms cannot be accurately detected by traditional methods, and the corrosion situation of pipelines in deeper formations can be understood in time
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment
[0032] Detection of Desulfotomaculum thermocisternum in the produced fluid sample of an oil production well in North China Oilfield
[0033] 1. Specific primers for sulfate reducing bacteria
[0034] The specific primer designed by the invention (forward: GCGTAGATATCAGGAGGAACAC, reverse: CACCT AGCACCCATCGTTTAT).
[0035] 2. Purely cultivate the thermophilic desulfurizing enterobacteria Desulfotomaculum thermocisternum, and determine its bacterial concentration to be 2×10 5 Pieces / mL.
[0036] 3. Serially dilute and culture Desulfotomaculum thermocisternum samples, and extract the diluted samples according to the instructions of Axygen Bacterial Genomic DNA Extraction Kit (Axygen Biotechnology Co., Ltd., USA). DNA to obtain standard sample DNA corresponding to different bacterial concentrations.
[0037] 4. According to the instructions of Axygen Bacterial Genomic DNA Extraction Kit (Axygen Biotechnology Co., Ltd., USA), extract the microbial DNA from the produced fluid of an oil well i...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention provides a specific primer pair (positive: GCGTAGATATCAGGAGGAACAC; negative: CACCTAGCACCCATCGTTTAT) for detecting sulfate reducing bacteria and a method for detecting the sulfate reducing bacteria. Desulfotomaculum theerocisternum in an environmental sample can be quickly and quantitively analyzed through the specific primer pair combined with a fluorescent quantitative PCR (Polymerase Chain Reaction) method. The method provided by the invention can be used for overcoming the defects in the conventional technology, and has the characteristics of strong specificity, convenience in operation, accuracy in detection and the like.
Description
Technical field [0001] The invention relates to the technical field of microbial detection and identification, in particular to a rapid detection method for sulfate reducing bacteria. Background technique [0002] Sulfate-reducing bacteria (SRB) is a general term for a class of bacteria capable of reducing sulfate. At present, 18 genera and dozens of species have been discovered. Although a lot of research has been done on SRB, the physiological growth characteristics of some SRBs are not yet fully understood, and their cultivation methods are also poorly understood. In addition, some SRBs are difficult to cultivate due to harsh growth conditions. Therefore, it is impossible to systematically and quantitatively analyze all SRBs depending on the cultivation method. Studies have shown that SRB in high-temperature environments is dominated by Desulfotomaculum. Desulfotomaculum is a medium-temperature or high-temperature type. It is a straight or curved bacillus with a size of 0.3~...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/01
Inventor 牟伯中刘金峰杨世忠王立影管婧
Owner EAST CHINA UNIV OF SCI & TECH