Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant human collagen and production method thereof

A technology of human collagen and collagen, which is applied in the field of genetic engineering, can solve the problems of long production cycle, high cost, and inability to put into large-scale production, and achieve low production cost, increased output, good hydrophilicity and stability Effect

Active Publication Date: 2013-05-29
SHANXI JINBO BIO PHARMA CO LTD
View PDF2 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Foreign research institutions have obtained milk containing human collagen by breeding mice containing human collagen genes, but the cost of production is too high and the production cycle is too long to be put into large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human collagen and production method thereof
  • Recombinant human collagen and production method thereof
  • Recombinant human collagen and production method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Construction and expression of HC8 gene expression vector

[0034] 1. The full-length gene sequence of human collagen HC8 after codon optimization is as follows:

[0035] ggcgagcgtggtgcacctggttttcgtggccctgcaggcccgaatggcatcccgggtgaaaaaggcccggcaggcgaacgtggcgcccctggtgaacgcggcgcacctggtttccgtggcccggcaggtcctaacggtatcccgggcgaaaagggtcctgcaggcgagcgtggcgccccgggtgaacgcggtgcccctggctttcgcggtcctgccggccctaacggcattccgggtgagaaaggtcctgccggtgagcgcggtgcccctggtgagcgcggcgcaccgggctttcgtggcccggccggtcctaatggtattcctggcgagaagggtccggcaggtgaacgcggtgcacctagatccggcgagcgtggtgcacctggttttcgtggccctgcaggcccgaatggcatcccgggtgaaaaaggcccggcaggcgaacgtggcgcccctggtgaacgcggcgcacctggtttccgtggcccggcaggtcctaacggtatcccgggcgaaaagggtcctgcaggcgagcgtggcgccccgggtgaacgcggtgcccctggctttcgcggtcctgccggccctaacggcattccgggtgagaaaggtcctgccggtgagcgcggtgcccctggtgagcgcggcgcaccgggctttcgtggcccggccggtcctaatggtattcctggcgagaagggtccggcaggtgaacgcggtgcacctagatctccggaattcggcccgcctggtccttgttgtggcggcggc

[0036] The...

Embodiment 2

[0041] Example 2 Construction and expression of HC16 gene expression vector

[0042] 1. The full-length gene sequence of human collagen HC16 after codon optimization is as follows:

[0043] ggcgagcgtggtgcacctggttttcgtggccctgcaggcccgaatggcatcccgggtgaaaaaggcccggcaggcgaacgtggcgcccctggtgaacgcggcgcacctggtttccgtggcccggcaggtcctaacggtatcccgggcgaaaagggtcctgcaggcgagcgtggcgccccgggtgaacgcggtgcccctggctttcgcggtcctgccggccctaacggcattccgggtgagaaaggtcctgccggtgagcgcggtgcccctggtgagcgcggcgcaccgggctttcgtggcccggccggtcctaatggtattcctggcgagaagggtccggcaggtgaacgcggtgcacctagatccggcgagcgtggtgcacctggttttcgtggccctgcaggcccgaatggcatcccgggtgaaaaaggcccggcaggcgaacgtggcgcccctggtgaacgcggcgcacctggtttccgtggcccggcaggtcctaacggtatcccgggcgaaaagggtcctgcaggcgagcgtggcgccccgggtgaacgcggtgcccctggctttcgcggtcctgccggccctaacggcattccgggtgagaaaggtcctgccggtgagcgcggtgcccctggtgagcgcggcgcaccgggctttcgtggcccggccggtcctaatggtattcctggcgagaagggtccggcaggtgaacgcggtgcacctagatccggcgagcgtggtgcacctggttttcgtggccctgcaggcccgaatggcatcccgggtgaaaa...

Embodiment 3

[0050] Example 3 HC8 and HC16 protein detection activity

[0051] Collagen activity detection method can refer to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 ( 2004). The specific implementation method is as follows:

[0052] 1. Use the ultraviolet absorption method to detect the concentration of the protein samples to be tested, including the control human collagen (Sigma, C7774), HC8 and HC16 samples. Specifically, the UV absorption of the sample at 215nm and 225nm was measured respectively, and the protein concentration was calculated using the empirical formula C(μg / mL)=144X(A215-A225). Note that it should be detected under the condition of A215<1.5. The principle of this method is to measure the characteristic absorption of peptide bonds under far-ultraviolet ligh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant human collagen and a production method thereof and belongs to the technical field of genetic engineering. The structure of the recombinant human collagen is a single-chain structure; the basic repeating unit is gergapgfrgpagpngipgekgpagergap which is a human collagen III peptide fragment; the terminal sequence is GPPGPCCGGG which is a human collagen II peptide fragment. The production method of the recombinant human collagen comprises the following steps of: constructing escherichia coli genetically engineered bacterium; fermenting and cultivating the escherichia coli genetically engineered bacterium; inducing and expressing the recombinant human collagent; and purifying the recombinant human collagen. According to the recombinant human collagen and the production method thereof disclosed by the invention, the escherichia coli expression system is adopted for being amplified in a large-scale manner, the production cost is low and the yield is high.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to a recombinant human collagen and a production method thereof. Background technique [0002] Collagen is a type of protein widely distributed in the connective tissue of the human body, and it is also the most abundant protein in the human body, accounting for 25% to 35% of the total protein. Its main functions are reflected in maintaining the extracellular environment, maintaining the normal physiological functions of tissues and organs, and repairing body damage. Collagen is a natural biological resource. It has biohistocompatibility, support elasticity and degradability for cells, which is unmatched by other polymer materials. Therefore, collagen can be widely used in industries such as medicine and cosmetics. [0003] However, natural collagen cannot be dissolved in water, and its properties are not uniform, so it is difficult to be used by the human body. It often n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/78C07K1/22C12N15/12C12N15/70C12N1/21C12P21/02C12R1/19
Inventor 杨霞陆路
Owner SHANXI JINBO BIO PHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More