Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction)

A fluorescence quantitative, lactic acid bacteria technology, applied in the field of bioengineering, can solve problems such as large flavor differences, poor process controllability, and product quality batch differences

Inactive Publication Date: 2013-06-05
JIANGNAN UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The production of vinegar in my country has a long history, but the fermentation process of many vinegar manufacturers is based on traditional experience, the process controllability is poor, and there are batch differences in product quality, especially the large difference in flavor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment one: the preparation of standard sample

[0039] 1. Design and synthesize specific primers for Acetobacter and Lactobacillus.

[0040] The primer sequences are:

[0041] Acetobacter specific primer sequence (5′→3′):

[0042] Ace-F: CGCAAGGGACCTCTAACACA

[0043] Ace-R: ACCTGATGGCAACTAAAGATAGGG

[0044] Lactic acid bacteria specific primer sequence (5'→3'):

[0045] Lac-F: AGAACACCAGTGGCGAAGG

[0046] Lac-R: CAGGCGGAGTGCTTAATGC

[0047] 2. Extraction of pure bacterial DNA.

[0048] isolated and purified Gluconacetobacter (Gluco nacetobacter sp. ) and Lactobacillus pentose ( Lactobacillus pentosus ) for shake flask culture, and DNA extraction was performed on the two culture fluids by using bacterial extraction kits.

[0049] 3. Cloning of target fragments.

[0050] The DNA of Acetobacter pasteurii and Lactobacillus helveticus were used as templates, and Ace-F / AceR and Lac-F / Lac-R were used as primers for PCR amplification. The amplified products...

Embodiment 2

[0060] Example 2: Quantitative analysis of the genus Acetobacter and Lactobacillus in the microbial community of vinegar fermented grains.

[0061] 1. Collection of samples of vinegar fermented grains.

[0062] Taking the fermentation of Zhenjiang fragrant vinegar as the research object, the samples of vinegar unstrained spirits at different time points during the vinegar fermentation process were collected. If the DNA could not be extracted in time after the samples were collected, they should be frozen immediately.

[0063] 2. Extraction method of microbial total DNA in vinegar fermented grains.

[0064] Weigh 2 g of vinegar unstrained spirits, add liquid nitrogen into a mortar and grind thoroughly, and transfer to a 50 mL centrifuge tube. Add 6 mL of DNA extraction buffer to the centrifuge tube, then add 100 μL of lysozyme (50 mg / mL), and shake at 225 rpm at 37°C for 30 min. Add 1.5 mL of 10% SDS to the centrifuge tube, bathe in water at 65°C for 2 h, invert gently every ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for conducting quantitative analysis on acetic bacteria and lactic acid bacteria in vinegar culture microorganism communities. The method has higher specificity and sensitivity and can rapidly and accurately quantify microorganisms of specific species in complex communities.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to quantitative research on the application of fluorescent quantitative PCR technology to specific species of microorganisms in solid-state vinegar-making microbial communities. Background technique [0002] The production of vinegar in my country has a long history, but the fermentation process of many vinegar manufacturers is based on traditional experience, the process controllability is poor, and there are batch differences in product quality, especially the large difference in flavor. This is mainly due to the complexity and variety of microorganisms in the brewing process, and the mechanism of microbial action in the fermentation process of vinegar grains is not clear. The brewing process of Chinese vinegar is a multi-strain mixed fermentation process, through the metabolism of various microorganisms to produce vinegar with full flavor and soft sour taste. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor许正宏史劲松陆震鸣王宗敏钱建瑛
OwnerJIANGNAN UNIV