Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method

A technology of reverse transcription primers and candidate targets, applied in DNA/RNA fragments, DNA preparation, recombinant DNA technology, etc., can solve the problems of incomplete genomic data, insufficient throughput, and difficulty in obtaining complete information of sheep skeletal muscle in batches, etc.

A technology of reverse transcription primers and candidate targets, applied in DNA/RNA fragments, DNA preparation, recombinant DNA technology, etc., can solve the problems of incomplete genomic data, insufficient throughput, and difficulty in obtaining complete information of sheep skeletal muscle in batches, etc.

CN103194441AActive Publication Date: 2013-07-10XINJIANG ACADEMY OF AGRI & RECLAMATION SCI
3 Cites 4 Cited by

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method
  • Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method
  • Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1, obtaining the miRNA candidate target gene whose name is mir-133

[0050] The miRNA used in this example is mir-133, and its nucleotide sequence in the 3' to 5' direction is GUCGACCAACUU CCCCUGGUUU . The nucleotide sequence of the 5' to 3' direction of the reverse transcription primer A is CTCGACTGAGTTGCCGTGAGTCGGCAACTCAGTCGAG CCCCTGGTTT (The underlined base is the mir-133 seed sequence ๏ผ‰ . The nucleotide sequence of reverse transcription primer B is AACGCGTCGCGTCGAGTAGTAGACGTA TTTTTTTTTTTTTTT. The nucleotide sequence of primer A1 is TGAGTCGGCAACTCAGTCGAG , the nucleotide sequence of primer B1 is AGCGCAGCTCATCATCTGCAT . Among them, primer A1 and primer B1 are nested primers.

[0051] The specific method is as follows:

[0052] The total RNA of skeletal muscle of sheep (Chinese Merino sheep) was extracted using commercial Trizol reagent, and the total RNA of skeletal muscle was purified using the Oligotex mRNA purification kit. Divide the purifie...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining a miRNA (Ribose Nucleic Acid) candidate target gene and a special reverse transcription primer for the method. The method comprises the following steps of: (1), acquiring cDNA (Deoxyribonucleic Acid) first chains corresponding to mRNA which is complementary to a target miRNA seed sequence to obtain a storeroom A by using the DNA with a stem-loop structure and the target miRNA seed sequence as a reverse transcription primer; (2), acquiring cNDA first chains corresponding to mRNA of the eukaryote target gene tissue to obtain a storeroom B by using the DNA with a special joint and 14-20 deoxidized thymine nucleotides as a reverse transcription primer, wherein the structure of the reverse transcription primer B is the special joint-T14-20; and (3), synthesizing the storeroom A and the storeroom B to obtain a double-chain cDNA, then hybridizing to obtain a hybrid DNA molecule, amplifying the DNA segment between the target miRNA seed sequence and the special joint on the hybrid DNA module and obtaining the target miRNA candidate target gene according to the amplification products.

Description

technical field [0001] The invention relates to a method for obtaining miRNA candidate target genes and special reverse transcription primers thereof. Background technique [0002] MicroRNA (microRNA, miRNA) is a class of small molecule non-coding RNA, about 22 bases in size. It causes the degradation of target gene mRNA or the inhibition of target protein translation by binding to the 3'untranslated region (3'UTR) of the target gene. Studies have shown that the biological function of miRNA is realized by regulating the target gene, and miRNA participates in various biological processes such as cell proliferation, apoptosis, differentiation, metabolism, development, and tumor metastasis by acting on the corresponding target mRNA. Controls the formation, development, metabolism, and occurrence of certain diseases including animal and plant organs. [0003] miRNAs combine with target genes in an incomplete pairing mode, which makes the regulatory network of miRNAs and their ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
10 Jul 2013
Publication
CN103194441A
IPC
C12N15/10; C12N15/11
Inventors
็”˜ๅฐšๆƒ; ้ซ˜่•Š